Description :
From Genome Similarity Track
Location :
Scaffold_22:170473- 173741
Sequence
3268 bases(100 bases per row)
CTGGAAGCATTTTCTGCGCGATCTGAAGTCAGGAGACATCGAGCAGGTCTGCTTGATCACCGAGTCTGCCTCGGCGGAAGAGATCCACACGGTCGCTACC
GACAATCTTCCACTTCGTCCAAAGAACGCTGAGCCGAAGTCGGCGCGCGAAGAGCGCTTCGCTGTCCAGTCGTGGGAGTCACTCCGCGACTCGGGCAATC
CAGTATACGACACCGTTCGCGAGTTCGCGGATGTTTTTCCCGACAAGATTCCAGCTGAGCTCCCTGCTGACAGAGGCATTCGCCATGAGATTGATCTCAC
GCCGGGTTTCAAGTACTGTGTGACGCGACAGTGGCCCCTCCCACGCGATCAGGTTAAAGCCATTGACGACTTCTTCGAGAGCCGCCGCAAAGCGGGTCAC
GTGCGCGAGAGTACCTCGCCACACTCGAGTCCGACGTTCTGCGTGAAGAAGGCCACGGGTGGTTGGCGCATTGTTCACGCTTTTAACAAGCTAAACGACG
CCACCATTCCAGCACAAACGCCGATCCCTCGGAAGGATATGATACTTGACACCATGGGCCGCAGTGTTATTTTCAGCACCATCGACCTGACCGATGGCTT
CTATCAGATCTTGATGCGACTCAGCGACGTCCCGCTCACAGCGGTGAGCACTCCCAGCGGGATGCTGTCGGAGTGGCTTGTCATGCCGCAGGGCCTGAAA
AACGCACCAGCCACGTTCAATCGCATGGTTTCCCACGTTCTGCGCCCACTTCGCGACTTCGCTCCGAGCTACTTCGATGACATCTTCGTTCACAGCCGCG
CTGAGGGCGATCTCAGCGCCACAGAAGCTCACTTAAATTACTTACGACAAGTGTTCCAAGTCATGCGCGAAAACAAACTGTACGCGAACTTGAAGAAGTG
CATCTTCTGTGCCCCGGAGATTTCGGTGCTTGGCTGTTATGTGAGCAAAAATGGTGTCCGAGCGGATCCTGAGAAGGTCTCGTCCATTTGTGCGTGGCCC
ACGCCGCAGAATCAGACTTGATTGCGTCAGTGGCCTAGCCCTCGCAAATTATCTCCACCAGTACACGAAAAATTATGCTGGTCTGATCCAGCCATGTCTT
CATTGCTGAAGTAAGACATCACGTGGTCGTGGACTCCCGAACAATCAGTCAGCCTTTAATGCAGTGAAGAAAAGCTTGGCGGAGGCCCCAATCCTGGCGC
TCCAGATGATGCAAGCCATTCCACGTTGTTTGCGACGCGAGCGACTTCGCCATCGGCTGTGCACTGATGCAGCTCGACGACGAAGGTCGCGAACGCGTCG
TGAGCTACCAATCCAGACAGATGAAGCCCGCTGAGAAGGATTATCCGGTCCACGACAAGGAACTCCTTGCGATGCGCTACGCACTGATCAAATTCAGAGT
GTACTTACTCGGTGAGCAGACATTCGCGATCTACACAGATCACGCGTCGCTGCGAACAGCGACGAAGAGCCCTCATCTCTCTCAGCGCATGGCACGATGG
CTGTCATTCTTCTCCGAGTACAACTCGTCGTTCACTACAAGCCAGGCAAGAATAACATCCTTGCGGATGCCCTATCTCGGCGCCCCGATTTCGATCCACG
CCGAGATTTGGGTCGTCAGTCATATGAAGACGCGGACGACGACGAATTGGACTGCGCCACATGTGTGGCTGCAGGTGTGAACCTGATGACGACGGTATCT
CCAATACTTCCCCTGCGGGAAGAGATCTCTGCCGCGTATCGAGATGACTCGATATATGCCGGTATCCTGGAACACCTTCGCACACCAAGTGATGCCACGC
TAAAGACACTGAGCCGCTTAACGCGCGACCAGATTCACAGATACCAACTTGACGGTGATCTACTGATGTACAGTATCGATCGATTCGATGCTCCTCGCGT
CGTTGTCCCCAACGACCCCGATCTACGCGCAAGAATAATACACGAATTCCATGACGCTCCAGTGGGTGGCCACTTGGGCCGTGAGAAGACTTTCGCAGCG
GTATCCCGCGACTTCTACTGGCCTCACCTATACAAGTGGATGCGCAAGTGGGTCCGCTCCTGCGAAACTTGTCAACGCGTTAAGCCGTCACCGTCATCGT
AAGCTCCGCTTCGTTCTCTCCCTCTGGCGACAGAGGCGTGGCGCTCTGTGTCAGTGGACTTCATATTCGGTCTCCCACCCGATACTGACGGTCGTACTGG
TGTTCTGGTCTTCGTGGATCGCTTTAGCAAGATGTGCCATCTCGTTCCGGTTCCGGACTCAATCACCGCGGCCGATACCGCGGTGCTCTTTGTCGACGCT
GTCTTCCGACATCACGGCCTTCCTGAATCAATCGTCTCTGACCGCGATCCCCGATTCACATCGGCGTTCTGGACGAAACTCTTCGACCTCCTGGGCACCA
AACTCCTCATGTCGACGGCGGCGCACCCGGAGACTGACGGGCAAACGGAACGCGTCAACCGCGTGCTAGAAGATGTTCTGCGCAGTTATGCCCCGTCCTT
CGAGAACTGGAGTTCCTTCCTGCCTCTTGCGGAGTTTGCACTCAGCAATGCCGAGCACGCGTCGACGGGATTGACTCCGTTTTTCGTCAACAACGCGCGT
CATCTACGTGTCCCCGCACAACTTGCTGTGGGCCAACCCACGGCGACTGATGGCTTCACTCTGGAGGGGGAGGAATGTGATAACCCTGCCCAACCGGTTC
CGATACTGGTTCAACCACCGGTTTCCGGTGAGACAACGGTTCTGCCGTCTACGAGTTCAGCTACTCCTGCAGTAGACATCAACGCGGTGACGCGTTTACA
GTCGAAGAAGATCCTCGCACCCGCGCAATCCACGTCGTCGCCGTTAGTTGACTGGACACACCGAACGCTGATCGCTCCAGCACAGCCACACTCGACTGTG
ACTAACTACGCGCCGAAACCCCCAGCACGACCCGCTGACAAGGCAGCGGTATCCGACTTTGTCCTTCATCGCCAATCGGTTACCCAATTCGTCCGTGACG
CGCTACAACTCGCGGTTGACAAGCAGAAGAAAAACGCTGACAAACGTGGCCGCAAGAACACAAGTGCATTCAAGATTGGTGAGCGGGTATTACTCTCAAC
GGATGGAATTCGTACCTCTGCTATTACGAACCTAGGCGCGAGCAAACTCGCGCCGCGCTACATTGGGCCATTCAAAGTACTACGAGTTATGGGTGATGCC
TACACGCTAGACATTCCTACGTCGCTACGACTACACCCGACGTTCTACGTCGGGCGACTTAAGAAGTA