Description :
From Genome Similarity Track
Location :
Scaffold_324:17045- 20083
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_324-snap-gene-0.15(Fragment)
Pytve_DAOMBR484maker-pve_contig_324-fgenesh-gene-0.7Conserved gene of unknown function

Sequence
3038 bases(100 bases per row)
CCGTAGTTGTGGTCGTGATCGCGACCGTGACCGCGACCGCGACCGTGATCGTGATCGTCGCGATGGCATGGACGACTGTCGAGCGGACGACGTCGAAGAT
CTCGGAGGCGACCGTGGACGACGAGAGGTCGGTGAGCGAGATCGGGACGATAGTCGAGCTGACGGCAGCGAAGCCCTTGGGGGTGATCGCTGCGATGGCG
CGGATGATGGTTGCGTTGTATTCGTCGTTGGTCTTTGGTGTGATCGTGATATATGAGGCGGCAGTGGCTGCGGTCGCTGAGGCGCCGATTCAACCCGAGG
AACTGTCGTCGATGACTGAAGCATGTGACTTGGAGGAGGCCGGTGAGAAGCTCTTGCCTCTTGCAAGTGAAGCGGATGCATCGCGGGCTGTGGTTTTGAC
TTCGACACTCCACTTGATGACTGTGGTCGTACTGGAGCAGTTAATGTGGTTGGTGCCACGTCACTTGAGTTCTGTGGCCGCTTTTGTACTTGGTGCTCTC
GTGCAGTTGGCGTCACAGAGTTCAGCCGAGTTGCTGGTGGCTTCAATGGTTCTGGCGTCGATCTTGGTAGATGATTCATCGCCGCATCTTGCAAAGCCGG
AGATTTAGTCTGCAGTTCTATCGACGACGATTTCTGCTGTGCTGACGCGGGGGGTGAAGGAGCGTTCGCCTTGGAATCTGAGGAAGCTGCTGGGATACTG
TCCTTCTGATGCTCTAAAGCTTTCTCTTCGCCAGCACTGGCCATATTAGCATCGGCCGCTGCCTGTTTCCTCTTCAGCTTGCGTTCATTCTTCGTCAAAG
TGAGATTGTCAAACAGTATCGGGTTTTCTTGCCGGAGTCGCTCCGCTTGTTCTTTCAATACCATGCCTTCCTTGTCGAGCGCTTTGAGATAGTCGTCCCA
CACCGAGCGAATCAAGCGGCACATATCACTGTTCGGATCCCGACAGCGCCGGCGCTCGAGCTCAGCCGCCGCATCCTTGTACTTCTTGACGCGGGCTCGA
AAATCGGCTTCCGCCTCCTGTTTCTGTTGCCTTTGTAGCTTTGCTACTGTCTTCTGTTCAGCCGCCGCAGCTCGTTTCTTCTCAGCAGCCGCGGCTGCCT
TTGTTTCCTGCCTCTTGAACTCGTCTGGTCTCATCTTCTTCAGCCAACCTTTGAACTGTACAGCGCGGACCACAGCGTTCGCCGATGTGGTAGAACCCAT
GCAGTCGCGGCAACGGCGCAGGTCTTGATGTCGTCGCTGTTTCTTCGAAAACGCTGCGGATGGCAGATCGCGCTCGCAGCAGCTACACTGAATGTTGCCG
CGGTCCTTCACCACTAGTGTCAATGGGAAGCTACATAGCGAACACTGCCGCGGTGCTGCATCAGCCGCCGGATCCGCTGCTGTAGCGGCCCGTCCCTCAC
TAATTGTCTCGGCACTCGCCTCTGTCGCTGGTTCTTGCCTTGCATCGCCTGGCGGGTCGAATGGTCCACCGACTGGCAACTCGCGAGTAGGTTGAACAGT
CTTCGCTGACGGCATCACCGCCCCGGACACTAGCGCTGGCGCTGGCGTATTGTCATCGCTCTCGATAAACATTGGGGCTATATCGTACGGAGGGGCGGGA
GCTTCAGGAGCAGGCATCAATCCTGGCGCACCACCGATCTCCTGGAAGAGGTCCAATATGTTGATTGCGGATGCGGCCGTGGACGCATCTTCACGAGGCG
ATGGCGCATACTGAGACGCAACGAGGGAGGGTGTTGCATCGGTAGGTCCTGCCGGAGGGTCTGCACGCTGCGCGTACTCGTCGTCGTCGTCGTCGTTGTA
GGGCTCGCTCTCCGTCGAACTGCCATCATAGCAGTCCATACTCCCACATGTGGCCAGAAATGACAGTGCGTCCCCAAAATAGCGATCTAACAAGGGATCG
AACAGCAGTACCGTGATTTTCGCAAATTGATCTCCAAACGAGCACTCTTCTACCCGAAAGTATACCCCCTCTCTTCAACCATCCCAGTGTTCATCAAACT
ACGCTGACAATGCGCCAGTCCACGTCCTCGGGCTGCGTCACCATCGACTCGAAGCGCCAGACCGGTGCCGACTCGCGCTCGATCGACTGGACCGGCATCT
CGGGCGTCGTCACGTCCAGTGACTCCTTGATGTGGAACTGAACATCGAGGCGCATGCGCTCCACCATGATGGCGTGGTCCTCGGGCGTGATCTTGGCGAC
CAGCTCCTCCGGCCGCACTTCCACCGTCACATCTTCAAGCTGTCGGTCTTCCGGTCTGCCTTGCTCGGCGTCGAGCCGCGCGAGCTGCGCGCGAGAGAGC
TCTTCCAGCGCGTGCTCGCTCTTGAGCTCCGCGAGCGAGAGCCGGTCCCAGTGCACGCCCGACAGGTAGACGCCGTTGAAGTCGAGCTGCGTGAGCGAGA
AGGACGTGCCCGACTTGGTCGTCTCCTGCATGGCGAACACGAACGCGTCAAAGCACGCGCCGGAGAGACCCTGCTTCAAGGTCTCGGCAGCTGGCGACTC
GCGCGTTTTGCCCGTCGCAAAGTTGATAAACTCGCGCGAGTACATGGTGTTCATCGTCAGGTCGCACGCGAACTTGGCGCCGTCGAGGAAGTCCACCGCG
TCGATCTCCGTGTTGGTCGGCAGCTGCAGCTTGTTGTACAGCACGTAGTTATACAGCCCCAGATGGGACGGCGGGAACACGTTCTCTCTGCGGTACCGCT
CCAGCTGACCTAACCTGTCCACACAGCGATTGGCGAACTGCATGAAGCCGTCGAACCCGTCCAGCAGCGATGGCTTGGGGCTCGACGACGACGAAAACAG
GCATTGCTGCCGGGTTTTGATGGGTAACACCAAGCATTCGTCCAGTCAGACCTGCCAACAGAGACACTCACATACGCAGCGCTGTGAAATGAGCCATACC
TGAGTCAGTGCTGGCTTGGCGCGCGCTCTAGAGACGCGGCCGAGGCCGCGGGTGGCCGTTGCGAGCCGCAGCATCGGTGGAATGGGCCGCTCCTTATCTT
TGGTGCGTCCAAGTCAATCGGCTCACTCTCTGTCCCGA