Description :
From Genome Similarity Track
Location :
Scaffold_415:170419- 172638
Transcript NameFunction/comments
Aphin_H310_06210Vtype proton ATPase subunit H putative
Aphin_H310_06211Hypothetical protein

Sequence
2219 bases(100 bases per row)
GCGTCGATCGCTCATTCAGGTCAACCACACACACACACACACCCATCCATCCAAATGCACAACGTTCCATCGACAAACGACAAGTGGATCGAGAGACTCA
GGGACACAGGGATCGGTCATGCCCGCCGCCGCCAGACACCAAACACGGTGCGGGGTCGAAGAAGGGATGGCGTACCGAATCAGTTCAAACTCGTTCGCTT
CGAACGACATGACGTTTTCACGCCAAAACTTTTCCGTGTGCAGCAATCCCCACGCCAATGACCCAGTGCGAACTTCCTTTTCATATCGCTCCATGGTACT
ACAGACAAAACGACGATGTAACACGAATGCCGACGGAGAGCAACGTACTTGAGCTCCTTGAACTCGCGGATGAGCACGTCGCGAATCGCCGTGATCGACT
TGGCAATGTCCTCGTCAGTCCACTTGCGATCGCGCAGGTTTGTCAGAGTCTTGAGCAGCCCACCGTCGATCATGCGTTCGTTGTAAGCGCCGTTGGCTTT
GCCAAGGAGGTTCTATAGCACCAAGACGCCGGTGGTGAGCCTCCATTCTCGACCAATCCGACAAAATCCATCATGCATCGGCAGCACAGCCAACGTTTCA
GCCCATGTCTCCGCAGCCCAGCTCTCAGCACGGAATGCATCGATGGCCGACTTGGTCGGCTGCCACCAACACGATAGAGGAATCACATATGCAAGATACC
TCGAGCGCCTCCAACGACACACGCACGACCTTTTCACGGGGCGCGGCAACCACTTGTTGGATGAGAGCGGTGATGGCCCCCGACGACCCAAACGCTTCGA
TCGCTTCGTCCGAAAACGACAACGTCCACAAGCAAAAGCAAACCTGGCGACCCCAACAAGAGTGAGCGCTACACATCCTCGACAGAGGAAAATTCCACTC
GCAATGGATTCGAGGTATACCTCGTACGCTAATTGCGCCTTCCCTTGCGAGTTCTTGAGCACATCGGCCAAGCTGTGGCACAAAAGAAGAGTGGGAACAG
TGGAGGATGCATGCACCGTTGGCAAAAGAAGTACCTGGCAAGGCCCCCAGCACGGGTGAACAGTTTCCGCGCAGTTTCGCAGCGGAGGAGCACCATGAGC
GTCGTGATGGCATTGCGGGCGGTGGCACCGAGGGCGGTGTCGCTCGACTGCGCCGACGCCTTGACAGCGTCCAAAATCCATTGAATCAACGACACAATGT
CTTGTTCTTTCCCACGGAATGTCAAGAACTGCGCGAGAATGTGGCCAGCCGCGTACTGCGTGTACCCCGACTCACTACGAAGCAAGCGGAGGAAAGGCGC
TGCTTCGACATACGTCCCGTCTGGTACAAAATACGTCGCACGCTTGCGCGATCGACCGCCATCTACCAGCGCAAACACGTTGTCGTTACCGAATGTCGTG
CTGAGCTGGTGGCTGGCGCAAGGGAGGCACCGTACCAGGCAACAGATCGTCGATGCGGGCAAATGCATAGCGCAACACGGACGGCTCCGTGACGTTCTTG
ATCAGCTTGAGCAATCCTGCACCCAAAGCCGCGCCATATTCGCGGAGGAACGTATCGATCAACGAGTCGGTTTGATCTTCGTTTTGGCTCGCGTTTTTAG
CCACGGTTTCCATTTCCTTGATTGCGGTGATCTCGGCCTTGTCCAAAGAGAACCCACCCGCACGCGTATACGTAGCCCAGTTGATGTCCTTGAACTTGGC
CAGCGCTTCTTCGCGCGCCAACGCGACATCAAGCGCGTTCGCCTTGACTGCCTCCAGCACTTGCGACGACGACACGCTCATCTTTTCGTCACTTCCCTTT
TTTGTGGGGTTGGGTTTTTCAGAGCAAGGGGGTCAGGTTTGAAACATATTTAAAACACCTGTTTAAAACATACCGAGGGAATCGCAACAGATTGTAACAC
CCTTCGTTGCATTGAAAACGCTCATGCTCGTCATGTTATAATCTGCTGAACGAGGAGCATGTATTTAAAATTGGACCGTCCTGGTCCAACCTCGTACAAA
GCATAGCATGTTGAATGAGTTGGGAAATTTATTGAAGTCGGTTGATTTTTCGTATTTTAAATGGATTGGAACTGTTACATTGTCACAGGAATTGCTCCGA
CAGCGATGGACGTATTCCACACCCACGTCGGGGCGTTCTATGAAGCGCTGGCCGAAGAACAGCTCGATCATCTCGCCGATGCACTGCTAAATCTCCGACA
TGCTGCTACAGTGCTTCCT