Description :
From Genome Similarity Track
Location :
contig_24:170415- 171574
Transcript NameFunction/comments
g5366.t1RAW28786.1 hypothetical protein PC110_g14855 [Phytophthora cactorum

Sequence
1159 bases(100 bases per row)
TCATGCAAAACTTTGTCCCCATCTCTTTGAACGTCTCGCTGGAGTTCGTCAAGTATTGGCAAGCCTACTTTATAGAGCAGGACCTGGAGATGTACGACAA
GCAATCCGATACTCCTGCAATGGTGCGATCATCAGCTCTCAACGAAGATTTAGGCCGCGTGCATCATGTCTTTACGGACAAAACCGGCACGCTCACGATG
AATCTTATGCTCTTTCGTTACTGTATGGTTGGAGGACGACATTACGGTGGTCTGATGCAAGACAACGATATGGTAGCGGAGGAGGCCAACGAGCCTTCAT
CTCCCTCGATGGCTGCCATAAATGATGGCCCACGATTTGTTGACTTCGACCCAAGCGAGCTGTTTGCCGACATTCAGGCAGGAGGAGAGCAGGCGCAAAC
TCTTCGTCGATTTTTACGGCACTTGGCAGTTTGCCATACGTTGATCCCGACCAAATCGTTTGCTGAAATGTGCAGTACGTCTTTCCCAGAGTACTCTGCG
TCATCGCCCGATGAACAGGCACTAGTTTCTGCAGCGGCCTTCTGTAATGTGCGCTTTGTGCACAGAACACCCACTACCATGATGGTCATGGAGCCAGGTT
GGGCAACTCCTAACACATACAAACTGCTAAATGTGCTGGAATTTGACAGCGACCGAAAGCGCATGACGGTAATTGTAGAGGCCCCCGATGGTGCGATTGA
ACTCCTTTGCAAAGGCGCGGACAATGTCATTTTTGAGCGTCTTGCAGCGGATCAAGCGACTTTGCCTGGTGGTATGTCTAGCGAACAAGCAGCTGAACAA
CTCACGCTGTACGCGAAGGCTGGTATGCGCACGCTCTGCCTCGCTTATAAAACGATCGGCAGATCTGAGTACGAGACATGGAGTGCCCGTTATACGCAGG
CGCATGGTTCGATGGAGGAATTAGTAAAACGACGTCAAGGCCGTGCAAATGCGATTGACCCGCTGATGAACGAGATTGAACGTGATCTTATCCTACTTGG
GGTCACTGCGGTCCAAGATAAACTCCAAGCTGGGGTGCCTGCAACACTTCGGCTCCTGCAAGAGACCAACATAAAGGTTTGGACACTCACAGGTGACAAA
ATGGAGACTGCTGTGAATATTGGGTATGCCAGCGCGCTGCTTTCTCACGATATGAATCT