Description :
From Genome Similarity Track
Location :
Scaffold_119:170411- 171692
Sequence
1281 bases(100 bases per row)
TAGACGCTGATCTTCTCATGGCAATATTCACCCCTGTTAGGGAGATCGTCCGAGGCCAAATTCAATCCCCGGGACGACTACAGGTCACTTGCTCTCCACA
AAGCAAATTGAGGTCTGTATTGATTGATTTAGTCCCTAGGGTCGAAGTATACACGAAACTTGTCCGGGCCAATGCTCATCTCAGCTACGATTGTCATGCG
AGGCAAATCCAATCCCCGTCGAAACGCCACACGTAGTTGTTCTCCACTTGATGATCCCGTTACGATTCCGTGCCCCCTTGTTCTCTAGTTCGTGATCTTG
GCTACTTCATAGTGAGACTTAATGCTTGGCGGGCGGAGTAGACGCTGAGCTTCCCATGGCCAGTATTCACCCCTGTTAGGGAGATCGTCCGAGGCCAAAT
TCAATCCCCGGGACGACTACAGGTCACTTGCTCTCCACACAGCAAATTGAGGTCTGTATTAATTGATTTAGTCCCTAGGGTCGAAGTATACACGAAACTT
GTCCGGGCCAATGCTCATCTCAGCTACGATTGTCATGCGAGGCCAAATCCAATCCCAGTCGAAACGCCACACGTAGTTGTTCTCCACTTGATGTTCCCGC
TACGATTCCGTGCCCCCTGGTTCTCTAGTTGGTGATCTTGCTTACTTCATAGTGAGACTTAATGCTTGGCGGGCGGAGTAGACGCTGAGCTTCCCATGGC
CAGTCTTCACCCCTGTTAGGGAGATCGTCCGAGGCCAAATTCAATCCCCGGGACGACTACAGGTCACTTGCTCTCCACATAGCCAATTGAGGTCTGTATT
GATTGATTTAGTCCCTAGGGTCGAAGTATACACGAAACTTGTCCGGGCCAATGCTCATCTCAGCTACGATTGTCATGCGAGGCCAAATCCAATTCCCGTC
GAAATGCCACACGTAGTTGTTCTCCACTTGATGTTCCCGCTAAGGTTTCGTGCCCCCTTGTTCTCTAGTTCGTGATCTTGGCTACTTCATAGTGAGACTT
AATGCTCGGCGGGCGGAGTAGACGCTGAGCTTCCCATGGCCAGTATTCACCCCTGTTAGGGAGATCGTCCGAGGCCCAATTCAATCCCCGGGACGACTAC
AGGTCACTTGCTCTCCACACAGCAAATTGAGGTCTGTATTGATTGATTTAGTCCCTAGGGTCGAAGTATACACGAAACTTGTCCGGGCCAGTGCTCATCT
GAGCTACGATTGTCATGCGAGGCCAAATCCAATCCCCGTCGAAACGCCACACGTAGTTGCTCTCCACTTGATGTTCCCGCT