Description :
From Genome Similarity Track
Location :
scaffold_732:1704- 4897
Transcript NameFunction/comments
g10069.t1 hypothetical protein PHYSODRAFT_340298

Sequence
3193 bases(100 bases per row)
TCGCCTTCTTCTGAAGTTCCTCGGCACATGCTTGAGCGTAGCTGTAAGCTTGCTGCATCTTTCGACGCCACTCGTAAGCAGTGCGCTCTTGGATCGTCGA
GGGCTTTGGTCCCAACATCGCAGACACAGTCCCATGTGCATCCCACCCATGCACCAGATAGAACGGGGTGTCCAGACGTGTCGCGTCAAAAGAGGTATTC
AGAGCGAACATCAGGCGCTCAGCCTGGTCGTCCCAATCACTCTGGTCAGCTTCAGCAATATATGCCTTGACCGCGCGCACCACAGTCTGAACAGACCTCT
CCTGTTGGCCATTGGCTTGTGGGCGGTATCCCAGAGTTGCACGTTGTCTGGACCCTAGAAGCTCTCTGAAAGACTTGAACACTTCGCTCATGAACCGTGG
ATCTTGGTCGTGGCGTATTTGAGAAGCTCGAATTTCTGAAGACACGTTCCTCATACGCTTCGGCCACGTCCTGCGCAGTGGTGACACTCATGGGTTTACA
CATGACATATCCAGAGAACATATCCTGAAATAGCAGTAGGAAGGTATTGCCTCGGGCGGACTTCGGCATGTGCGTCACAAAATCCATGGACACCACCTCA
AACGGTCGACTGGACTCAATGTTCCCAGGCGAAGGTCCAGGATTCGGAGGGCGCCCCTTGCCGCTGGCACAATCCACACACTCTTTCACGAATCTCTCGA
CGTCAGCGTACATGCCCAGCTAGTAGAATTCCGAACTCAGCTTCTCGAAAGTCCGCTTGATTCCCTGATGACGATCTTGGTAATCTTCGTGAGCGTAGTG
CAGTAAGTCTGTATGCAGATCTCTGGGAACCACGAGTCTGAGTTCATCGACCATGTCTCTCGGACGTTCTCTGGTGGCACGACTCAGGCGATACAGCACA
TCTCTGGAGTCCAAGACGAAATCTTCTGCGACTCTCGCAAGATTTCTGATTCGTGGACGTGGTAGGCCTCCCACGTCGCCTTTCAGATACTTGGTGAGTT
CAGAAAGGTACGGGTCTTGACTCTGATGCGCCTTGATTTGTCGCCAGCGTTCTGCTTGGAATTCTAGAGGGCCAAGTGGTCCGTGATCTTCATCATTACC
AGACGCTTCAGGCTCTTCCTCAGCTCGGGCACGAGTAAGAGCAGCGAACACTCTGGCAGCAGGTGGAAGTGGGGCAGATTCAGGCCCGGGTGTTTTGGAC
TCCAGAGTCACAATCGGAGTGTCAGACTCCTGATTTTCAGACATATGTGCTCCAGGCGTCGTGACTTTCCGAGGCTTCATCAGCTTCTCGTGGATCTTGG
ACACCAACTGTAAATGAGTGAGCTCGTCAGCATCTTCCACTCGCCACGATTCACCAAGTGCCAACGTCTTCAAGGTCAGGTAGTCCGCAGCCTGATTGTA
TTCGCGCTTCACATGCAACAACTTTAGAGAACTGAACTTGGGTTTCAGAGACTCGAACTCTGCTAGTCTCCGTTGCAGGTTAGGCTGGTTGCAGTTGATC
AAATCTTGGGCCTGCTGGATAGCAATACGAGAGTCTCCAACTACCACGATCTCCCGAACACCACGTTCCAACGCCATCTTCAGACCGTTCACAAGTCCAC
AGTATTCAGAGTCATTCACAGTGACGTCTTTCAGAGTGAAGCCTTGGGCTTCCAGAACATTCTAGCCAGGGAGTTCCCAAAGTACGCATCCACAACTTCC
CAGACGCGTAGATGTCTTTGCAGCTCCATCGAAACTCAGAGCAACTCCTTTGTAATCAGTTTCCAACATTTCCACACTATCGGCACTGGTGGCTTGACAC
GCCCCTTGGCTGGATTCAGGTTTTCAGAGATTTCGTCAAGATGCTCACGCGGAGTGATACCTGCGCCAAGAATAGCCGGGAGGCCATCCTCGTCGCGTAA
AACTCTGCGAATCTCCAAATTCCAATGAGATAACTTCAGACCCCACTTCACGTTCCGGCCGTCTCCGGAGTCTGAAGTCAGAAGCCACTTCAACACGGAG
TACCTGGTATACACTACGACCACCGGACCCGACTCTACTAGAGCTCTAAAATTCTCCAGGATTCTGAGAATCGCAATCACCTCTTTCTCAGCGATATGAT
ACCGGAGCTCAGCGTCATTCAGAACACGTCCAGTGAGCCGGACTGTGTGTATCACACCGTCATACTGTTGTCCCATGACCGCTGAGGCAGCCCAAGGGTT
CGCGTGAGGGATAATGACGAAGGGTCTGGACCGGTCTTGGTGTCTGAGAAGTGGTGAAGATCAAGAAGATCCTCCTGGTCGCGGAGACGATCTCCGTCAT
CGTTATCGCCGTGTCGAGACAATCTTACGCTTCAGAATTTCAAAAGCTTCTTTGGCACGTGTCAGGTCCCGTCCAGCCCGAATCTGCTCATCCGTCAACT
CGTAAAGTGTAGCAGCAATCACGGGTAAGTCCTCAATAAACTTGTTGTAGTAATTCAGACTCCTCACGAAACTCTGAACTCCTTTGAGTGTCGACGGAAA
CGGTAACTCTGTGACTCCCTTGGCGATCTTCGGAGTAGCTCTCAGACCCTCAGCACTAATCTCATGTGAGAGGTACGGGATCGAAAGTTTCCCAAACTCA
CTCTTCGGCTGGCTGACAGAGATATTCCAATATAGGAGTCTCAATAACAAGGCGTTCCGATCTTCGCAGAGTTGGTCCCACGTTGGTGCACCATGGGCGA
TGTCGTCAATGTAGGAACTTCGACCTAGTACCGGTCCGATTGAAGACGGTAAAGGGATGTTCCTCTGGAAGACAGTCATCTGCTCGGTCAGAGCCGGTAA
TTCAGACTTCAGAGCTTGTACTTCAGACTTCTGAGGCCCCAACTTCAAAAATTCAAGGACGTCACGGTCAACTTCGGCTTTTTCTTCAGGGGACAGTCTC
ACAAATCCCCACAAGCAATTATCCAGCATCGCCTGATATATCAGCGGAGCGTTCTTCAGGCCGAACGGCATTCGGACCCACTGAAAGTGCCCGAACGGAC
AAATGAACGCAGAGATTAGTCTGGCACGCTCTGTCATTCGGACTGCCCAGAAACCACTCGCCATATCCAGACTCATAAACCACATCGCCGACTCGAAACC
AATCAAAAGATCATCCATGAGTGGCAAAGGGTAACGCGACAACTGAATAAAACCATTCACCACACGATAGTCGATACACATGCGAATGTCCAC