Description :
From Genome Similarity Track
Location :
contig_60:170391- 177700
Transcript NameFunction/comments
g10703.t1hypothetical protein
g10704.t1XP_009515921.1 hypothetical protein PHYSODRAFT_552366 [Phytophthora sojae
g10705.t1hypothetical protein
g10706.t1hypothetical protein

Sequence
7309 bases(100 bases per row)
TCTGGTACCATTTTCGTACCTTATCCGGTCACTGCACAATAATGATCCTACCGCGAGCCAAGGGGAAGGACGACAGCGCGGCTGCGGGAGCCTCCGCCGC
CGCCACCATCTGCGAGCTGTGCGACCTGTACACGCACAACGACCTAGACGGCAAGTGGATGGAGCTCGCAGCAGTCTACGACGTACGTTAGCTCGTCGCC
CATCGACCCCACACTGCCAACACCTAACGCTGAGATGTGTCAATTCTTCCCTGCAGCAACGCCATAATGTCGACAACTTCCGGGAGATTCTGGATCTGAG
CAACCCCGACGCACGGATGGGCGACCTCAATGGCTGGCACTTGGAGCGCATGGCCGTGGGGGAGTTTGAGCCGGGGGCAGGCGCCAGCGCCAGCGAATTG
GCGGAGATCAAGCGTGAGAGCCTCCTCATCAAGCAGACGCTGATGAAGGTGATGGCCAATGGCCGCAGCTTCAAGGCCAAGAGAGACGATCTGGAGGCGG
CCATGGCCAAGCAGCGTGAGGAGCTGTCTGCTGAGCTATCTGAAGCCAAGGAGTTTCTTGGCCAGGCACATTTGCTGAACGCCTGTGACTCGGCTGCGAT
CGAGGTTAGTGAGCCAGCGCCTGTGGAGGAGCGACTGCGAGCGACGGTCAAACATCCAGAGCTCTCGCCGACAGTCGATCTCAGCGAAGCACCGTCAATC
TGATGTTGTGAGACGTTAGATGGGGAGGTAAGCGAGTGTGGAATGAAAAACAGGGCGATACACGAGTGCATTCCTCCGGTGCTCTCCCAAATCGGTCACG
CTCTAACTGTAACTTGGTTTGGGGCCACCTGCTCCGTTCTCGCCCTCCTGACTGTCTGTACATGCCGCTGTTTGCTACTGCTCTAGTCGACGTGCAGACG
GTCCTCAAGGTACTTGACGGCGTCCTTCGTGATGATCAGCAGGTCCTTTTGCAGGATCGAGTAGACGTTGATCTTGTTCTGCGGGAGCGTGTCCACGTAC
GGGATGTTGCGCGTCGCCAAGACAAAGCTCGAGTCCACCTCCTCGCCGCCAACGAACAGTGCGTGGTCCCAGCCGCGGCCACCAAGCAGTTTCTTCATCT
CCTTCGTCTTGGTAACCTGTTCGACACATATACACCACGTCAATATCAACTCAATAACCACGACAACAACAGCAGCAACGTACGTCAACGTCAAGCGAGT
CCACGACGGCCAGCTTCCCCTCACGGAGCTTGGTGGACAGCGCCACGCGCAGGCCCATGGCGCGCACCTTCTTGGGCAGGTTGTACGAGAAGTCGCGCAA
CACGGGGCCGTGCACGCGGTAGCCTCCGCGCCACTGCGGCGCGCGGATGTCACCTACGCGGGCGCGGCCCGATCCTTTCTGCTTCCACGGCTTGCGCGTG
GAGCCGCTCACCTCGGAGCGCGTCTTAGTCTTGTTGGTGCCGGCGCGACGGCACGCGAGCTGCCAGCGCACCACGCGCTGCAGGATGTCCACGCGGTCGG
GCGCGCCGAACACCTCGCTGTCCATTGTCACGGAGCCCAGATCCTGCGCGTCCTCGGTCAGCGACAGCACTGCAGCTCGAGGTCGCCCGCGGGCGTCACC
TTGACGTCCTGCGCGGCCGCGATCACGCGCGGCGGCGGCTGCGGCTTCTCCTCGGCCAGAGCTAGGTTGGCCGGTGCGTGCGTGCTGGCGGCACGCACCA
GACAGGACGTGCGCGGTGCCGATACGGAAAGCGCCGCCACGCCGCGCAGCAGTCGGTTCATTCCCACAGTCGCCATCGGTTCCCCTTTGAGCTGCTCTTT
GCGTGCGGCTCTGGTTGCGAGTGGATGGCGTCCATCTTGAGGTAATGGTACACCATATTGGTGTAAAAATACACACTCTTTGGTGACACAAAAGCGGGGG
TGGAACAGGCACTAAGCAAAAGTCAGACGGCTTTCCCCCGCATCATGGCGTCGCAGAGGAGAGGCTCCGCCCCGCGCGGGGACGGCAGCCTGGCCGCCAT
CTGCACGCTCATCGAGCGCAGTACCCTGGACCGCAAATCCAAGCTCGACAGCACGGGTCGTGTCTGCTACGTACGAGGAGATGAGCCGCCCCTGCGCACA
AATACTACCGATCTAATGTTTGAATACTATTGTAGGAGCTCAAGAATGACCCGTTGCTGCTGGACAGCTTCCCCATGGACCGGATCATGAAGGCCATGCG
CCGACTGGTGTGTGATTCGGACACGTCCACGCGCGCGGGGGCGCTCCGAGCGCTGCGCTACGCCATCAGCAGTAATGGCAGCATCAAGCACTTTGTGGAC
CTCGTACGGCTGCCTCCTGCTGCTTTAAATATTGCAGAGAAGTTAATAGTTGTGTGTTTCAATTGCAGAATCTGCCGGTGTTTGTGGTGCGGTCGCTGGA
GCGAGAGCAGAAACACTTGGCGGAGAGAGTTCAAGCGCTCAAGGTGGTGCGACGCGTGATGGAGATCGATGCGGCGCAGATGCCGACGGGTCTCGTGGCG
TCGTTGACGGCCGTTGCTGGACACAAGGACGACAATATGCGTCGAGTGTGTCTGGAGACACTGAGAGAGCTGGCGCTGCTGAACGTGGAGGTTGTGGCGG
AGGCGAACGGCACGAAGGTTCTGGTGGATGCGATTCTGGAGCCATCATTCCAGGATCTGGCCGACTCGCTGCTGATGACGCTGCTGCTCATTCTGAACGA
GCCGTCGACGCGCAAGTTTATCGAGCCTTTCGTGGATTCGCATGTACTGTTGGCGCCATTTACAGATACGGATCTGCCAGCAGGTAATGAGCGGCGACAG
CGGTGGATGGCCAGTCGTAACGCCATCGTGACGATGATGCGCTCGTGGGCAGGCATGGTGGTGCTCACGAGTAACCCGCAGGGCTTGCACTCCTTGATTC
AGTTATTGGTGCGACCGGTGGGCGAGGATGTCCAGAAAGCAGTACTGTCAACAATTTGTGAGATCTTTTACAAGAAGACAAGCTTCGACAAGTCCGCGAC
CGATGCAGCAGACACACCGGCACTCCCTATTACTCTGTCGAGCGCAGAGCAACTGCCCCTTGCAGTCAACCACAATTTGCTGGACAACTACACTGTAATT
ATTCTGCTGGCCATGATTCACTGTGGCATCCTGGAGGCTCTGGTGACTCTAGGTGCGGGTCCGTCTCGAGCATTGGCAGAGCCGGCAATTGACCTACTGG
CCGATATTCTGCGTATGGCCTCGCGCCTGTTGCCGGACCAACACTGCGCGTCTTTGCTTGCGCTCCCCCGCCTAGTTTCGGCAACTTCGCTTACAACGAC
CACCACAATGACCCTGGGAGATCACGCTAAAAGTCTTTTGGAGCGTCTTCAGCGTGAAAAGTCAATTCGGGCTAGTGAAATGCTGGGTGAGCTCGCTAAC
GCTGTCGGGGCCAATTCAGGTAGCATTGCTACCCGTGGTGTGTCACTAGTCTCGTACGGTGGCAGCGGTGTTAATGGTGTTCAGCTAGCGTCCGAACTAC
TTCGCGACACTAACCGACCATCGAACCTTCTCGCTCTCAGCAGATTGCAGGTGTGGTGCGTCTCCCATCATCTAGCGGCGGAGGTGGCCTTGGAGGAACT
GGCAGTAATTCTGCCAACTATGCTGTGGCAGCCCCCTCAACACAACGTGGCACTAAGAGCGCGACAGCGCTACTAAAGGACAGCTTGACATCTCGAGAGC
TGATGGTCCTCGAGCTGAAGCAGTCATTGGATGCACAAATGGATGACAGCACATTTAAGGACATGCTGCACAACCGTTCACGGGTGCTGACGGACAAAAA
CTACAAGAACTGGAACTGGGATATCATTTCGGAGATGCTTGAAGGTCCACTTACAAACCCGCAGCGACTCTCAGAGGCGATGAAAACCAAGTTCTTTAAG
CGCCTTTCAGGTTTCTTCCGTTGCGACCAAGGCAACAAAGGATACTTTTCGAATCTGTACTGGATCCAGACCACGTTCCCTACCTGCGCCCAGCGTGCCA
GATGTACACGCTGCTGTTAAACCACCCCGAAGGCTTGCTCTTCCTGAAAACTGATCGTCGTGGTCAATTGCTCACTGAAATTTCGTCTGCACTAGAGCTG
GAGGCACGTCCTGAGGCTGCTATTGTGGAGTCCCATATTGGCGTGCTAAAGGCGCGCATGTTCTCTCCTGATTATGTATCGCGGCGTATGCTACGCGAGT
ACTTCACACTTTTGGGACTGATGAGCTCAAGCAAAGAAGGTCTCAAGATGATGGAACAGTCAAACCTGTTCCAGCGGCTCTACGTCATGGGCACCACAAA
GGGACACGATTTCTTGTGTCGCCTCATTCTTGCCAACCTGGACTACTCTGTTGATGGAAGTTCCCGCAAGTTGCTTCAGTCTTGGATGATGGAAGGTTCG
AAGGCGCTGCGTCTGTATGCAACGTGTTTGCTGCGTGCGTTGCTGCGCTCTGAGGTGGCCGATTTTGATAAGTGGGGCATTGATGCGCTGGTGACTCAGC
TCACACAGGAAGAGGAGGTTGCCAAGGCCGCACTGAGTGTACTTGAAGAGGCCGCTGAGACGCCCGCATGCCTTCTGGCGATGATTCTGAAGCGGCCTAT
GAAGCTCATTCAGCTCAAGGATAAACGAGCAGAGTCGCTGCTTTTGAAGTCGCTCTCGCTTCCTGAAGGTCTGAACTTCCTGCGCGACACAGGCGATTGG
ATTCGGCGCACTCTAGCCGCCTGGCGTCGCGAAAAACATATCTCGTACGTCCATGCGGTGGAGCACGCGCTCTTCCGTGGTTTGCACCGCGATGCAGCGG
GGCGTGAGCGTGGTTCGAACAGTGGTTCAATAAATGCACGCCAGACGTGCTCTCCCACTCCTATCCCGGTGAATGTGCCCATGAAGCGAGGTGGCGGTGT
TGGGCTCAAACCGCCTAGTGGTGGAAGCAGCCAGCGATCACTATGGGGACTGGATTGGCTTTACCGTATGCCGTGGAACATGGAGGTGAAGATTGTCGGG
CCTCCAGGAAGCGGGCCTCCCTCGAGCCTCATCTTGGAAACGTATATTGATGGTGCTATGCGCGACGAGGATGAGACGACTGGCATCGATGACGAGCTTC
GCATGAACTCGATTCGTGTCAAGGGTATCGTTGTGGACGCACGCAACATGCCACAACCTGTGGTTGTGAACTCGCAACAAACATTACAAGCTTGTCTTTT
CCTGGGTACGCAACCCGTAGATCGGCGGGGTTTCACAAAGCCTCCCCCGCAAAGTAATGGAGGCTTCGTGTCCACAAGCGGATCAGCCAGTGGTGGAGGC
TCGGGTGCTCTTTCGAGTGATACGCAGCAGAAAATGCTACGAGCGCGGTCAGCGTCAAACTCAGCAGGAGGAAGCATGGATCGCTCCTCGGAGACAATGA
TGTCGTCGCTTGACTTCGCTGACACTGGGTCGTCTTCGTCTGAGGCAGCAAAAGAAGAGAACAAAGATTGGAGCTCGTGCCAACCTGAACAGCGCTCACC
ACAGTACTTGTCGGCACCAGAATGCTCGCTCTGTGCTCCAGGTGAGCGTGCGGTGTGGAACTTCCGTGTGGAAATGGACTCCGCGGCAGGCAGCAACACT
TCAAATGGCAGTGTGAAGCGTCTTATGCTCAAGTCTGTCGAGTTCACGTTGCAATTACTTCCTCTTCGTCCACGTACTGTGCCGCTGCCGGTACACTTGT
ACGGTGAACTGGCAAAAACCAGCGCTGGCTGCCAGATCCTGCACGCATCTGGGCACCTACCGGAGTTCCTTGCGTGCCTACGCGATGCTGCTAGTGTCCC
GCTTGAGAAGCGTGCTGCATTGTGGGCGCTCGGCCATGTGTCTGCCACACCGCGCGGCTACGATCTTTTAAACCACTACGCACAAGATTTTGTGGAGATG
ATTGTCAAATTGGCTACGGACTCTCCGCTGGTGTCGATTCGTGGTACTTGTTTCTTCGTACTGGGATTACTCGCGCGATCACCCGCAGGACGGCGACACC
TTGCACGTTTGGGCTGGGATGCCCCACGGGATGCATCGCGTACATCCATTGCAGTCCCGCAGAACTGCACATCTCTCTTCATGTGGCCGCCGTCTGGACC
ATCGAACCCATGCCCATTGACACAGACACCGCGAGCGTCGCCCCTACAACGATTGCTGGTGCGCAGGCGCGACAAGATACCCAACGATTGGCGTGAAGTG
CTGCGTTTTGTCGCGGACCTGAGTAACCACATCACGCAGAAGGAGGCCCATGCTTCGCTCAACAAACTCCGTTCATCGAAATCCGAGCTGTTTGAAGAGC
CGGTGCTGCTGATGTACGTGCACGCGCTACTGGAGAAGTACAGCTACCGATTGGCTTTACGCCAGTTTGTGCTCAACGCGTTCGACCGAGCAACACTGAC
GGATGAGGTGCTTGACACGCTTCGAGTCGAAGACGAAGAGGAGCAGGGGAACCAAACGCGTACTGGCCAGCGTGTACCCTCCGGGCGGGAGCTGCGGCGG
CGTCGCTCGTCGCCGTCGATCCCTTCATTTACGGCTTCGGTCCAGTCGCTCAACTCTGCCATGCAGGCAACGTCTGGTGTGTCGCGCATGTCGTCCATGC
AGAACGTCCTCAACGGTGGCAATATGGGCGACCACCGTTCCACGATGCGTTTGAACGCGCACAATGACCCCATCGATCGCACTGTGCTGCTCAAACGTAG
CCGCAAGCGCTCTGCCTTCTCAGAGAAGACCATTGTGTCGGCGCACCTGAAGCTGCTGTGTAGGTTAGGCTAAGATATACCTAGACGATGAGCTTGGCGT
AGCGTTTGCCAGTCGTTATTCTTTGGTGCACTATCTCTATTGGATTTACCTACAAAACCTCCCAGAGGCCATGTCCATGAGCGAGTCACCCATGTGGAGA
ACATCGAGCTTGCACAGCTTCCCGTCCAGAGCAGTGCACATGGTGATGGCACCTCTCAGTGTCTCCAGGCCGCTCCGTTGCACGCGCAGCAACGCCGTGC
TGGGCTCTTTGCTGTTGGCAGCTAATTTATCAAATGATAGGATGTCGAACTCACACGCCGAGGCGCCTACCACGCCGAACGCCGTCTTGAGAGTGTTGTC
CAGGGCGAATTTCAGGCGCTTCACGTCGCCCACAGGCACCGATCCGTCCTCGGAGAAGCTGGGAATAGAGATCAATATAAATTAGGTACTGGTATATATC
TAGTGATCTCTAATAATCCGTAATGGGACGTACATGGCGATTTTGAGGTAGCAGTGCTGGCCCTGCAGCGAGAACTTGTGGTGCGGCGCCGACGCAGGTG
CCGCCATTG