Description :
From Genome Similarity Track
Location :
contig_24:170388- 171547
Transcript NameFunction/comments
g5640.t1hypothetical protein

Sequence
1159 bases(100 bases per row)
TCATGCAAAACTTTGTCCCCATCTCTTTGAACGTCTCGCTGGAGTTCGTCAAGTATTGGCAAGCCTACTTTATAGAGCAGGACCTGGAGATGTACGACAA
GCAATCCGATACTCCTGCAATGGTGCGATCATCAGCTCTCAACGAAGATTTAGGCCGCGTGCATCATGTCTTTACGGACAAAACCGGCACGCTCACGATG
AATCTTATGCTCTTTCGTTACTGTATGGTTGGAGGACGACATTACGGTGGTCTGATGCAAGACAACGATATGGTAGCGGAGGAGGCCAACGAGCCTTCAT
CTCCCTCGATGGCTGCCATAAATGATGGCCCACGATTTGTTGACTTCGACCCAAGCGAGCTGTTTGCCGACATTCAGGCAGGAGGAGAGCAGGCGCAAAC
TCTTCGTCGATTTTTACGGCACTTGGCAGTTTGCCATACGTTGATCCCGACCAAATCGTTTGCTGAAATGTGCAGTACGTCTTTCCCAGAGTACTCTGCG
TCATCGCCCGATGAACAGGCACTAGTTTCTGCAGCGGCCTTCTGTAATGTGCGCTTTGTGCACAGAACACCCACTACCATGATGGTCATGGAGCCAGGTT
GGGCAACTCCTAACACATACAAACTGCTAAATGTGCTGGAATTTGACAGCGACCGAAAGCGCATGACGGTAATTGTAGAGGCCCCCGATGGTGCGATTGA
ACTCCTTTGCAAAGGCGCGGACAATGTCATTTTTGAGCGTCTTGCAGCGGATCAAGCGACTTTGCCTGGTGGTATGTCTAGCGAACAAGCAGCTGAACAA
CTCACGCTGTACGCGAAGGCTGGTATGCGCACGCTCTGCCTCGCTTATAAAACGATCGGCAGATCTGAGTACGAGACATGGAGTGCCCGTTATACGCAGG
CGCATGGTTCGATGGAGGAATTAGTAAAACGACGTCAAGGCCGTGCAAATGCGATTGACCCGCTGATGAACGAGATTGAACGTGATCTTATCCTACTTGG
GGTCACTGCGGTCCAAGATAAACTCCAAGCTGGGGTGCCTGCAACACTTCGGCTCCTGCAAGAGACCAACATAAAGGTTTGGACACTCACAGGTGACAAA
ATGGAGACTGCTGTGAATATTGGGTATGCCAGCGCGCTGCTTTCTCACGATATGAATCT