Description :
From Genome Similarity Track
Location :
contig_40:17038- 19109
Transcript NameFunction/comments
g8604.t1RAW26666.1 Transposon Tf2-6 polyprotein [Phytophthora cactorum
g8605.t1XP_008909821.1 hypothetical protein PPTG_14641 [Phytophthora parasitica INRA-310

Sequence
2071 bases(100 bases per row)
TTCCGGACAAGGTTCCAGCCGCCCTTCCACCCGATCGTGGCGTTCGGCACGAGATCGACCTCGTGCCAGGCGCGAAGTACTGTGTGACGCGGCAGTGGCC
GCTTCCCCGAGATCAAGTCGAAGCGATCGACGCTTTCTTCGAAGGTCGCCGGCAAGCCGGCCACGTCCGCGAGAGTCTGTCCCCGCATTCCAGCCCGACG
TTCTGCGTGAAGAAAGCCACCGGCGGATGGCGGATCGTCCACGCCTTCAACAAGCTCAACGACGCCACCATCCCGGCGCAGACGCCGATTCCGAGGAAAG
ACATGGTGCTCGACACCATGTCCGGCAGCACCAAGTTCAGCGCCATCGACCTGATGGATGGCTTCTACCAGATCTTGATGCGCGAAGCCGACGTGCCGTT
GACTGCCGTCAGCACGCCCAGTGGAATGCTCTGGGAATGGCTCGTGATGCCGCAGGGGCTCAAGAACGCCCCTGCCACCTTCAATCGCATGGTGTCAAAT
CTGCTCCGGCCGTTCCGCGACTTTGCGCCCAGCTACTTCGACGACATCTTCATTCACAGTCGTGCCGCGGGCGGCATGACGGACGTCGAGATGCACCTTC
AACACCTGAGGCAGGTGTTCGAAGTGATGAGGGAGAACAAGCTGTATGCCAACTTGAAGAAGTGCATCTTCTGCGCTCCCGAGATCCCAGTGCTCGGGAG
CTACGTCAGCACGGAAGGTGTCCGTGCTGACCCGGAGAAGATCGAAGCCATCTGCGCTTGGCCCGCTCCTCAGGATCAGAAGCAGCTCCGGCAGTGGCTT
GGTCTCGCGACGTACCTCCACCACTACTCGAAGAACTTCGCGGCAATGATCCGTCCGTTGTCGCAGCTTCTGAAGGCAGATGCCGCGTGGTCGTGGCGTC
CTGAGCACCAGTCGGCTTTTGACGCGGTGAAGACGAGCTTGTCCACCGCGCCCGTACTCATGCTTCCAGACCACTCGAAGCCCTTCCATGTCGTGTGCGA
CGCGAGCGACTTCGCGATCGGCTGCGCCTTGATGCAGTTCGATGACGAAGGGCGCGAGCGGGTCATCAGTTACCAGTCGCGCCAGCTGAAGCCGGCAGAG
CGGAATTATCCGGTCCATGATAAGGAGCTGCTGGCCATGCGGTACGCCCTCATCAAGTTCCGCGTATATCTCCTCGGCGAGCAGACCTTCGCGATCTACA
CCGACCACGCGTCGTTGAGAACAGCGACGAAGAGCCCTCACTTGTCCCAGCGCATGGCGCGCTGGCTCTCGCTATTCTCCGAGTACAACTTCGTCGTCCA
CTACAAGCCGGGCAAGGCCAACATCCTCGCCGACGCGCTCTCGCGTCGGCCAGACTACGTGCAGTCGGTCGACACGCAGTTGGCGACGAGGATGACGACG
AGTGCGCTGTGTGTGTTGCTGAAGAGGTCGCTGCAGTGGAAGTCGCAGCGACTACTCCACTCCGAGACCTGATATCGGCCGCGTACGAGGCGGACGCGGC
GTGCTCCGAGATGATCAAGTACTTGGGAGACCCGTCCGACACGGCGCGGCGCCGATTGTCCGCACGGAGCCGTGCCCGCATTGATCGATACCAACTGGAA
GGAGGCCTGCTGACATACAGCGTCGATCGCGCCGATCCGCCGCGCATCGTCGTCCCGCTGGACGATGACCTTCGGGCTCGGCTGATTCACGAGTTCCATG
ACGCTCCCAGCGGCGGCCACCTCGGACGCGAGAAGACTTTCGCGTCGCTCTCGCGAGACTTCTATTGGCCGCACATGTACAAGTGGGTGCGGAAGTGGGT
ACGCTCCTGCGAAGCGTGCCAACGAGTCAAGCCGTCGCAGTCGAAGCAGGCCCCGCTTCGACCCCTCCCAGTTGCGGCGGATCCGTGGTCTTCCGTGAGT
ATGGACTTTGTCTTCGGGCTGCCTCGAGATGCTCAAGGCCGCACTGGGATTCTCGTCTTCGTAGATCGTTTCAGCAAGATGCTTCATCTTGCTCCGGTCG
CTGTCACCATCACCGCGGCGCAGTCCGCGGCGATCTTTCTCGACATCGTCTACAGGCACCATGGACTGCCG