Description :
From Genome Similarity Track
Location :
Scaffold_450:17035- 19642
Sequence
2607 bases(100 bases per row)
GTTCCAGTTTCCCCAGTGCCTGACTCGAGATGCTTGGTAGACCGTTCCGCTCTCGTAACTTGTTGTCGATCATGTGCTCTGTTGTTGGTCGAAATACACA
GCATAGCTCATCATATGGTTGTCTTGTGTGCACGAGAGTATGCCACGCTTCCGTGTATTCGTCTGCCGGTGTGTTGATCCATCGTTCCGCCAAATTGCTC
CTGGTCGTCTTGAGGGCTCTCTTTATGTCCTGCAGGCCGAAACCGCCTGCTGTCTTGGGTGTAAATAACAGTGGATTGATTTTGTGCTTGCTGGGTTCTG
TGCTTGCTGATGAATTCCAGATAAATTGCTTCTGCATATTCTTGAGTCTGCTAATTACTGATTTCGGTGGCACATATTGTTTGCCCGTGTACAGTATGGC
TGGCAGTGCAACTGCATTGAAGAGCGTTATGCGTTGTATTACCGAGTTGCCCACCGTGGTCGCGATTCGAAGGCGTCGTTGTAGTTTTTCGATCCGAATA
TTCCAGTTCTCCATGGTTGGATCTGAGTTTCCTACCCAGTACCCCAGATATCTTGTTGTCTCTTTCGGTTGTAACACCGGGAATCCATGCCATTTCGTAG
GAGTCCCAACCGTGTTCAATCCTATTAGTACGCTTTTTTGCGGTTGTACTTGTAGTCCAGATAATTCCCCAAACTCCTTGAGGATTTTCTGTACAATCGG
TATTTCCTTCGCTGATTTCAAGTACACTGTGCTGTCATCGACAAATGCTGAGAATTTATGGTGGAGCGTTTTGCTGCCAGGGATGGCTATTCCCGTTAGG
TTTGGATGTTGGTTGATTGCTCTGCTGAGCATATCGACCGCCAGAATGAACAAGAGTGGCGCGAGAGGACATCCTTGTCTGATGCCCGAGGCCACTGTCC
ATTTAGTTGACAACTGCCCGTTAACCAAGAAGCTCGCTGTCGTTCCATTGTGTAGTCGCTGTATCACTGCTACAAACCTTTCCGAGAATCCATATCGTCT
CAGGACCATGAGGAGGAATGTCCGATCTAGCGTGTCGTACGCTTTCCGTAGGTCTAAGCTTAGTACTGCCGCAAAGTCTGCCCATGCTTTGGTTGGGTTG
TGTTCGCTTTCTGCTAGTATTGCTCGTAGTATGGTTCTTGTCTTGTCGATAGATCGTCCTCTGACAAACCCCTGCTGCGCTGCACTAATTAATTTGGGTA
GAAGTTGATGTAGTCGTTCTGCTAATATTCGCCCGAAAACTTTGTATGCTGTGTTGAGGAGAGCTGTTGGTCTGTAGTCCATTGCTTCCGCTGAGTCCCC
CTTTTTCCGAAGTGGGACTACGGTCGCGTCTAGGAACGTTTGTGGTACGTCCCCTGCTCCATCCAGTATAGCGTTAAAAAGTTTTGTGAGTCCTGGTGTG
AGTTCGTTCTGAAAGTCTTTGTAGAAATCGTGATTTAGTCCAGTTGTTCCAGCTGACTTGTTCCTATTTAGGTGTTCAATCGCCATTCTGGTTTCTCCTT
CCGAGATCTGCTCCACTAGCTTTTCTGCTTCTGCTGGTGTGAATTTGTGGTTTTCGGGGATGGTAACAAATTGTTTGAACGTCTCTTCTCTACTGTTTGG
CTCCATTTTTGCGTGAGACTTTCCGTACACGTGGCTCCACTCTGACGCCATTCTCTCTTCCGCTGGGTATTCATCCGCGTAAAAGTGTCCAGGTGAAGGG
TCAATAGTTGTGATTGTTTGATCCCGTTGCCAGTCTGAGTTTCGTTTGAAAAGGCGCCGTGTGTTTTCTGTTGTCAGTTGTAGGTGTTGTCCGAAGGATC
TTGCCGCTCTGGTTCGTGTTCCTTTTCGATCTGCTTCATTGATCTTTGCTCTAGATGTTCTAACCGTTCTTGTTAATGTTCGCAGGTTTTCAAAGTATCT
GCGACTTTGTTTGTCATCATCTCGTTTCACCTTTTGTAGTAGTTGTCGTATTTCTTCTGTGATTTGATCCCATGTTTCAACCGCGTTGGTTGCTTGTTCA
ATCCTGTCCATTATCTCTGCTAAGCCGGTGGCTATTGCTTGTTGTACACGTGTGGGTCGTCCTGTGTGGATTGGGTAGGGAATTTGTTGTTTTCCGGTTC
GAGGTGCTTGCTTTCCTGTTGATAGCTCGAGTCGTACTTCTCGGTGATCGGAGTCGTGTGCTGCGGTTATTACATCAACCCACTGAACCGCTGTGAATGG
TTCCCCTTTTACGTAGAAGCGATCTAGTCTGCTTGCTCCATCGTAGGTCCAGCACGTGTAAAAGTGCATTGGGTCATGGTCTTCTTCCTCGTCATCGAGA
TGTTTGGTGAGGCTAATCGCGTCGGAGTAATCCCATTTGTCCAGCATCGTTTGAAGTATTTTGCTTTCGTTTGAGGACGTGCTGAGCGTGCGCCCAGTTA
CTCGATCTTGATGTGGTGTCAGTACACAGTTGTAGTCTCCTCCAATGATCACAGATTTGTGTTGAGAGATCCAAGGTTCGAGGTCGGCGTAGAATTGGTC
TTGTTCACTTCTTTGAGCTGGTGCATATACATTTACTATTAGCCAGTCGTCTAGTTCCACTGCCATTACACGTGATGTCCAGCTTGCTTGCTGCCAAGGT
TTTATTC