Description :
From Genome Similarity Track
Location :
Scaffold_62:170343- 171525
Transcript NameFunction/comments
Sapdi_VS20SDRG_13679hypothetical protein

Sequence
1182 bases(100 bases per row)
ATGGTAGCGCAATGCTGTACGTCCCGACGAAGAAACGCATCGTGCTTGCTTCGTCTGCTCTTCAGTTCCACGATGCGTACGAGTGGAACGCCACCAAAGA
CAATAGCGTACGTGGGTACGGCGACAGGACAATAGCTATTGTCGTGTAGGATGTCGTGAGCCATGCCAGCTTGGTCGTGTACTTGCCTTCGTGCATGTAC
CTCGTGAGTGTTGCAGGCAGGTGCGTTTCGACGCTCGACACTGCATCTGTAGTCGAACGAGTAGACATCTCCGCGTATGGAATGCACACACGGGCGCGCT
CTTGCACAACCTGCGGCATGTGACACGAACCAGCATCTCGGCCGCGTGCCACGGCGCTGGCACGACGAGCTACGCAGGCACGCTCGACGGCCACGTCTAC
GTACGTTGCTTCCTTTTCCAACAAACGTCGAAGACCAGCAATAGCACATCAACGCCACGAACGCTTCGATTCTCAAGGAGAGGGCGCTGCACACGCAAGA
GGTACGCAATGCAAACTTTGCGGCACATTTTCTGAGGCGTGCCTAGGTCACGGGGTTGAGCTTGCTCCAGACAAAAGGCGCACATCGCCTTGTGACGATC
GCACTCGACGGCACTTGCGTCATTGCCGACATGGTGTCCCTGTCGCCGCTCGCCGCGCTCAACCACTGGCACGGCGTCAACTGTTTTCCCGCGAGCCGCC
ACGACACTGGCGTACGCGTCGTCCCGGCTTGTCGGTTACTGAAACACGGTGCTAGAACGAAGCCAGCCACGCGCACGCCTACCACGTGCCGCCCGACATG
CGCGAGGTGTACCCGGACTTTGCTCTCGATGCTCTCAAGCGCATCTTTACGGTCTACGACCCGCAAGACATTGGCGTCGCACCGCTCAGCGCCGGCCGGG
ACCTCTTTGTTGCCGTCACGCGCGTCGTCCAGCGCACTGTGTACCGTATCAACGAGGCGTACGTCGCGGCGGCCCTCGCAGCGTTCGCGCCGCGGCGACC
TGGCGCCATCTTGTTTACCGAGTTTCTTCACGTACGTTGGTCGACATATTCGTGGAAGCTCATGACAATGGCTCAGCTCGTGCTCGATACGTGGCACGGA
CGCGGTGCGGTTGTTGCTGCTATCACAGCCATAGCGGTCTCGGCCAAATACGACGTTGTCGTGACCGCGTCCTTGGACGGGA