Description :
From Genome Similarity Track
Location :
Scaffold_285:17034- 18698
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_285-snap-gene-0.19Adenylate cyclase

Sequence
1664 bases(100 bases per row)
CTAGTGATGCTGGTGCATCATCATCACTCTCGCGCTCGCCAACTCGGCGCGCGTCTGCTTCTCCTTGCGGAACCGGTCACCGATCTTCGCAGAGACGAGT
TCGTACAGCTGGAAGGAGATGCCCAGGTCCGCACGTTCAAAAAGCTCGTATTTGTGGGTCGTGAACGCACTCTGGATCTTCTTGTCCTTCTCTCTCTCTT
CCTCCTCGTCTTCGTACAGTCTCAACGCACTCTCACTGATCAGCACCTGGCCGCCCTTGCCCAGGTCGCCCATCTCGCGCGCCACGATCTCGCTGATGCC
CAGGTACGTCATCTTGCCGGTCGTCGGATGTTTCGCGCTGATGAGCTGCTCGTCACCGTCGTGGATCGCCATGCGCACGCGCAGTCCGTTGAACACCAGT
TTCCCCCATAGGTCGTACACACGCGGTGCATGGTCGGATTTCAAGATCGACGGCGGCCAGTGCACCTTGAGTAGCTTCTCCTGAATGTGGAGGCACCAGA
GTACCGCGTCCGAGACTCGGTGGAACGCCACCTGGAACGCATCGCCGCAGGTCGTGATCTCGTATCCGTTACAGCGCAGCAGTTCCTGGCGCAGGAGGTC
ATCGTGGAGCGACTGTGCGTCCGACATCGCCTGCGGGTCTTTCGCCCAGAGCGCGGTCGAGCCTTCAATGTCCGTGCACACAAAGACCGGGCGGAACATC
GGCGGCTCGACAAATCGGTCGCAATTCGCCCGCGCTTCAGGGAAATAGCCTTCTTCGAGAAGCTGCTCGTACACTGACGGAGGCATGATGGGCCGCAGCG
TGTTGTAGCAGCACGTAACGCTCGTGCCGATCACCAGCGCCGACGCACCGCCGGATAAATAGTACAGCGCCTGACTCACGCCAACCCAGAACATCGGCAC
GTCGATGATCCGGATGAGGAACTCTACAAGGCACGCGGGAAACACGAGCATGCAGTAGACGATCACCAGGTTGCGGATGCGCCGCTGCAGGAACGTGGCA
CTCGGCGGCACGACGCGCCTTGTGCGCTTCTTCATCGACAGGAACAGCGAGCAGCCCAACGGGTACAGGAACGAGATCCAGACGCACGCCAGCTGGAAGT
TGAGCGCGATGTCGCGCACGGTACGCTCCTGCTTGGGGGACATGAGCGCCGAGAGCGCCATGAGCAGCGCAAACACTGTGGCGATGCCGTACGTGCGGAT
GCAGTACTTGCGCACGATCTGCTGCTCGCGCTCGCGGCCGCGGTCCATAGACTTGGCGATCAGGCGCGTGAGCTCGTACGCGAGCGAGAAGACCCAGAAG
GTCATGCAAAGCAGCGCGACGTCACCGACGAGCGCGATAGCGACCACCATGCCCTTGCCGCTGCTAGCCGTCTCGGCCTCGTCACTCGCGTAGATGACGC
GCACGCCCACGAGCTGGCCATTCTCGACGTCGTCCAGCAGGTCGCGCACGCCGCTGTAGTTGAGCAGCACGCAGAGGTAGAACACGAGCCGCGCGAGCGA
GTAGACGAAGTAGGAGCGCACGACCGCGTAGGTGATGTACTGCACGGCCGAGTGGTCCGCCTGGATTTGCTTGAACGACAGCGCCAGCGCCGCCAGCGCC
GTCGCGGTCGCGAGCCCCAGCACGAGCGCGTAGATGAGCGTCCAATTGTACTGCGAGTCATCCA