Description :
From Genome Similarity Track
Location :
contig_30:170323- 171820
Transcript NameFunction/comments
g6545.t1hypothetical protein

Sequence
1497 bases(100 bases per row)
TAAAGCTGACGTCTGGCTTCTGGCTCACGTTCCTGGTCCCGCTCTTGCAGCCATTCCAATACGGTTGGTCCACATCCCAGCTGAACCTGAACACCTTCAA
CAATGAAGAGGAATGCAATGCTCGACCTGTAGTGGACGGCACCTGCATCATGTTTCCTGGACACCAGAAGGCCTCGTGGACTTTAGGTACGGCCAAGCTC
GTGGTTTCTGTGTGGAAGCCTTCTTACTGACTTGTGCTTGGTTGTGACTTGACCCAGCCGTTAACCTTTGGGTTATCGGTGGTATGTTCGGCAGTCTTTA
CTGCGGCCCCCTCGCCCAGCGTCTGGGGCGTAAGAAAGTCTTCACGATAAATGCCATCGTCATGTTCATCGGCTCCGTGATCCAGACCACGTCCTTTGAC
ATCGCCCAATTCATCGTCGGCCGCTTCATCGCGGGTCTCGCGTCAGGTGTTGCAACGGGTCTCGTCGGCAGCTACATTTCCGAGATTTCGCCACCGCACC
TCCAATCCGTGCTACATCTCGGTCTTCAAATCTCCTTTACCTTCGGACTGCTAATGGTCGTCGTTTTCTTTTTTTTCGCCGATACTGTCGCCGGATGGCG
AGTCATCGCGGGTTTCCCCGTGATCAATGCCCTCCTCTTCCTGGTCCTCGCACCAGGGACAATGCTAGAAAGCCCCGTTTGGTTATTGGCTCAAGACCGG
CGGGCCGAGGCAATGAAGGTGGTCTCGCGCATATATGGCCCCGACGGAGTTCAGCACGCTCTTCAATGGCTGGAAAAACCTACAAGTGACTCGGCGGACA
GCGCTTCGACAGAGCCAGAGGAGCAGGAAGAAACACTGAACGTGTGGGGCTTGATCACGTCTCGCAAGTACCGCAAGCCGCTGGTCATCGCCATCGGCGT
GGCATGCGCGCAGCAGATCACGGGCATCGACGCCATTTTCTTTTACTCGGCAACAATCTTCGCTCGCGGCGGCATCTCGGATGGCCGCATCGGGTCGGTG
ATTGACAACCTGCTCATGCTTCTGCCGGCTTTCGCGTTGATCCCGCTCACGCAGCACTTCGGCAACCGGAAGATGATGATTGGCAGTGCTACGGGCATGT
TCCTGAGTGCGACGGCTCTCACGATCGCGTACATTTGCGACGTACCGACGCTTTCGGTCGTGTTCACGGCCACGTTCACGCTATCGTTCGCGCTGGGCTG
CGGGCCGTTGATCTGGGGCGTCACGTCCGACCTCTTCCCTCCGTCGCAGCGACCCACGGGCGTGTCCATCTGCATCGCCATCAACTGGATCTGCAACCTA
CTAGTGGGCGTCGTGTTCCCTTACATGAACGACGGCCTCAAGGACTACTCGTTCGTGCCGTTCATGGTTGTGACGCTGCTGTACGTAGTCTTCTTCACCT
GCTGCATGCCGGAGACCATGGGCAAGACGTCGGGCGAGATCCAGGCGTGGTTCAGCGGCGAGAAGAGCGAGCCCGCGCACTCACAGCAGTAGGCAGT