Description :
From Genome Similarity Track
Location :
contig_40:17032- 19103
Transcript NameFunction/comments
g7313.t1hypothetical protein

Sequence
2071 bases(100 bases per row)
TTCCGGACAAGGTTCCAGCCGCCCTTCCACCCGATCGTGGCGTTCGGCACGAGATCGACCTCGTGCCAGGCGCGAAGTACTGTGTGACGCGGCAGTGGCC
GCTTCCCCGAGATCAAGTCGAAGCGATCGACGCTTTCTTCGAAGGTCGCCGGCAAGCCGGCCACGTCCGCGAGAGTCTGTCCCCGCATTCCAGCCCGACG
TTCTGCGTGAAGAAAGCCACCGGCGGATGGCGGATCGTCCACGCCTTCAACAAGCTCAACGACGCCACCATCCCGGCGCAGACGCCGATTCCGAGGAAAG
ACATGGTGCTCGACACCATGTCCGGCAGCACCAAGTTCAGCGCCATCGACCTGATGGATGGCTTCTACCAGATCTTGATGCGCGAAGCCGACGTGCCGTT
GACTGCCGTCAGCACGCCCAGTGGAATGCTCTGGGAATGGCTCGTGATGCCGCAGGGGCTCAAGAACGCCCCTGCCACCTTCAATCGCATGGTGTCAAAT
CTGCTCCGGCCGTTCCGCGACTTTGCGCCCAGCTACTTCGACGACATCTTCATTCACAGTCGTGCCGCGGGCGGCATGACGGACGTCGAGATGCACCTTC
AACACCTGAGGCAGGTGTTCGAAGTGATGAGGGAGAACAAGCTGTATGCCAACTTGAAGAAGTGCATCTTCTGCGCTCCCGAGATCCCAGTGCTCGGGAG
CTACGTCAGCACGGAAGGTGTCCGTGCTGACCCGGAGAAGATCGAAGCCATCTGCGCTTGGCCCGCTCCTCAGGATCAGAAGCAGCTCCGGCAGTGGCTT
GGTCTCGCGACGTACCTCCACCACTACTCGAAGAACTTCGCGGCAATGATCCGTCCGTTGTCGCAGCTTCTGAAGGCAGATGCCGCGTGGTCGTGGCGTC
CTGAGCACCAGTCGGCTTTTGACGCGGTGAAGACGAGCTTGTCCACCGCGCCCGTACTCATGCTTCCAGACCACTCGAAGCCCTTCCATGTCGTGTGCGA
CGCGAGCGACTTCGCGATCGGCTGCGCCTTGATGCAGTTCGATGACGAAGGGCGCGAGCGGGTCATCAGTTACCAGTCGCGCCAGCTGAAGCCGGCAGAG
CGGAATTATCCGGTCCATGATAAGGAGCTGCTGGCCATGCGGTACGCCCTCATCAAGTTCCGCGTATATCTCCTCGGCGAGCAGACCTTCGCGATCTACA
CCGACCACGCGTCGTTGAGAACAGCGACGAAGAGCCCTCACTTGTCCCAGCGCATGGCGCGCTGGCTCTCGCTATTCTCCGAGTACAACTTCGTCGTCCA
CTACAAGCCGGGCAAGGCCAACATCCTCGCCGACGCGCTCTCGCGTCGGCCAGACTACGTGCAGTCGGTCGACACGCAGTTGGCGACGAGGATGACGACG
AGTGCGCTGTGTGTGTTGCTGAAGAGGTCGCTGCAGTGGAAGTCGCAGCGACTACTCCACTCCGAGACCTGATATCGGCCGCGTACGAGGCGGACGCGGC
GTGCTCCGAGATGATCAAGTACTTGGGAGACCCGTCCGACACGGCGCGGCGCCGATTGTCCGCACGGAGCCGTGCCCGCATTGATCGATACCAACTGGAA
GGAGGCCTGCTGACATACAGCGTCGATCGCGCCGATCCGCCGCGCATCGTCGTCCCGCTGGACGATGACCTTCGGGCTCGGCTGATTCACGAGTTCCATG
ACGCTCCCAGCGGCGGCCACCTCGGACGCGAGAAGACTTTCGCGTCGCTCTCGCGAGACTTCTATTGGCCGCACATGTACAAGTGGGTGCGGAAGTGGGT
ACGCTCCTGCGAAGCGTGCCAACGAGTCAAGCCGTCGCAGTCGAAGCAGGCCCCGCTTCGACCCCTCCCAGTTGCGGCGGATCCGTGGTCTTCCGTGAGT
ATGGACTTTGTCTTCGGGCTGCCTCGAGATGCTCAAGGCCGCACTGGGATTCTCGTCTTCGTAGATCGTTTCAGCAAGATGCTTCATCTTGCTCCGGTCG
CTGTCACCATCACCGCGGCGCAGTCCGCGGCGATCTTTCTCGACATCGTCTACAGGCACCATGGACTGCCG