Description :
From Genome Similarity Track
Location :
Scaffold_25:170280- 171347
Transcript NameFunction/comments
Phyra_77528alpha,alpha-trehalose-phosphate synthase

Sequence
1067 bases(100 bases per row)
CACATGCTCCAACTGTGGCTCGTTATCGACGAATGCGTGGACAGCTGCAATGCCAGAGCAATAATACTTAGCGCCCAGGCGCCCAGCAAAAAGTGAGTCA
CACGTACCCTGAAACACCTTCTCATCGGAGTCGTCGTCGCCCACGATAAAGGCAAACTCAGGTACACCAACCCGATCCTTTAAAACCTTCAGGATTAATG
ACACTGCCACAGCTTTGCTGACCCCAAACTGATGCACCTCCACATATCCTTTTGCACGGATGATCGTGGCTTCGCCCCTCTGTTCACGAAATAGTGAAAA
GGTGAGAACTTCTACAGAAATCCGAAGAAGTGCAATGCTACAAAAACGTACCTCGACAATTTTCCGGAGTTGAGCACACAGCTCCAGCGACTGGATCTCT
CCGTATTCTTGATCGCTGTTGCGGTAATCGTACAACAATGACGCTGCATTCTCAACAAGAAAAGATCCATTCGTTCGTGCTGCGTATGCCTGCATCACAC
GTTTCACGTCGTCTTTCCAGTCGAACGTCCGCTTGTCCTCATCGCATACACATTCCCAGCGACTTCTTCCTGCTTTTCGTATGAACAAGCCGTTCTCTGC
TATGAGATTCAAATTCGGAATTGAACCAAATTGATCGTCAAGCGCTGCGCGCTGAGTGTTACTGGCTACAAACACGATGTTGCACGGATCAGCGCAGAGT
GTCCAGAGGTTAGCTCGGGTTTCGTCAGAAATCGGCTTTCGAACTTTCCCATCAATGTATCGAGCGGCCGTTTGACCCGTGCAGTCTCCATTACGGTCGC
TCATGTTCAAACTATGGGACGACTGATTAGCACAATCGTCGCGGTGTGAGAACTGAGCTCCCTCCTCATCCAAAATGCTTGCAGTAGAACTTAGGGTCCC
GCCATAATCGAAAATGAAGAGTCGACGGGACGTGCTTGTACATTTCTTGACTAGCTCGTCGACATCCAGGTTCACAAATCCCGACTCAAACCGCATAATA
CGAAAGTCAAACCCGAAACCAACCTGAACCACTTCACCTGACGAAGCTTCTTCTGTCTTGGCTGTAA