Description :
From Genome Similarity Track
Location :
contig_60:170260- 177567
Transcript NameFunction/comments
g9082.t1hypothetical protein PHYSODRAFT_349212
g9083.t1hypothetical protein PHYSODRAFT_552366
g9084.t1hypothetical protein
g9085.t1hypothetical protein PHYSODRAFT_472278

Sequence
7307 bases(100 bases per row)
TCTGGTACCATTTTCGTACCTTATCCGGTCACTGCACAATAATGATCCTACCGCGAGCCAAGGGGAAGGACGACAGCGCGGCTGCGGGAGCCTCCGCCGC
CGCCACCATCTGCGAGCTGTGCGACCTGTACACGCACAACGACCTAGACGGCAAGTGGATGGAGCTCGCAGCAGTCTACGACGTACGTTAGCTCGTCGCC
CATCGACCCCACACTGCCAACACCTAACGCTGAGATGTGTCAATTCTTCCCTGCAGCAACGCCATAATGTCGACAACTTCCGGGAGATTCTGGATCTGAG
CAACCCCGACGCACGGATGGGCGACCTCAATGGCTGGCACTTGGAGCGCATGGCCGTGGGGAGTTTGAGCCGGGGGCAGGCGCCAGCGCCAGCGAATTGG
CGGAGATCAAGCGTGAGAGCCTCCTCATCAAGCAGACGCTGATGAAGGTGATGGCCAATGGCCGCAGCTTCAAGGCCAAGAGAGACGATCTGGAGGCGGC
CATGGCCAAGCAGCGTGAGGAGCTGTCTGCTGAGCTATCTGAAGCCAAGGAGTTTCTTGGCCAGGCACATTTGCTGAACGCCTGTGACTCGGCTGCGATC
GAGGTTAGTGAGCCAGCGCCTGTGGAGGAGCGACTGCGAGCGACGGTCAAACATCCAGAGCTCTCGCCGACAGTCGATCTCAGCGAAGCACCGTCAATCT
GATGTTGTGAGACGTTAGATGGGGAGGTAAGCGAGTGTGGAATGAAAAACAGGGCGATACACGAGTGCATTCCTCCGGTGCTCTCCCAAATCGGTCACGC
TCTAACTGTAACTTGGTTTGGGGCCACCTGCTCCGTTCTCGCCCTCCTGACTGTCTGTACATGCCGCTGTTTGCTACTGCTCTAGTCGACGTGCAGACGG
TCCTCAAGGTACTTGACGGCGTCCTTCGTGATGATCAGCAGGTCCTTTTGCAGGATCGAGTAGACGTTGATCTTGTTCTGCGGGAGCGTGTCCACGTACG
GGATGTTGCGCGTCGCCAAGACAAAGCTCGAGTCCACCTCCTCGCCGCCAACGAACAGTGCGTGGTCCCAGCCGCGGCCACCAAGCAGTTTCTTCATCTC
CTTCGTCTTGGTAACCTGTTCGACACATATACACCACGTCAATATCAACTCAATAACCACGACAACAACAGCAGCAACGTACGTCAACGTCAAGCGAGTC
CACGACGGCCAGCTTCCCCTCACGGAGCTTGGTGGACAGCGCCACGCGCAGGCCCATGGCGCGCACCTTCTTGGGCAGGTTGTACGAGAAGTCGCGCAAC
ACGGGGCCGTGCACGCGGTAGCCTCCGCGCCACTGCGGCGCGCGGATGTCACCTACGCGGGCGCGGCCCGATCCTTTCTGCTTCCACGGCTTGCGCGTGG
AGCCGCTCACCTCGGAGCGCGTCTTAGTCTTGTTGGTGCCGGCGCGACGGCACGCGAGCTGCCAGCGCACCACGCGCTGCAGGATGTCCACGCGGTCGGG
CGCGCCGAACACCTCGCTGTCCATTGTCACGGAGCCCAGATCCTGCGCGTCCTCGGTCAGCGACAGCACTGCAGCTCGAGGTCACCCGCGGGCGTCACCT
TGACGTCCTGCGCGGCCGCGATCACGCGCGGCGGCGGCTGCGGCTTCTCCTCGGCCAGAGCTAGGTTGGCCGGTGCGTGCGTGCTGGCGGCACGCACCAG
ACAGGACGTGCGCGGTGCCGATACGGAAAGCGCCGCCACGCCGCGCAGCAGTCGGTTCATTCCCACAGTCGCCATCGGTTCCCCTTTGAGCTGCTCTTTG
CGTGCGGCTCTGGTTGCGAGTGGATGGCGTCCATCTTGAGGTAATGGTACACCATATTGGTGTAAAAATACACACTCTTTGGTGACACAAAAGCGGGGGT
GGAACAGGCACTAAGCAAAAGTCAGACGGCTTTCCCCCGCATCATGGCGTCGCAGAGGAGAGGCTCCGCCCCGCGCGGGGACGGCAGCCTGGCCGCCATC
TGCACGCTCATCGAGCGCAGTACCCTGGACCGCAAATCCAAGCTCGACAGCACGGGTCGTGTCTGCTACGTACGAGGAGATGAGCCGCCCCTGCGCACAA
ATACTACCGATCTAATGTTTGAATACTATTGTAGGAGCTCAAGAATGACCCGTTGCTGCTGGACAGCTTCCCCATGGACCGGATCATGAAGGCCATGCGC
CGACTGGTGTGTGATTCGGACACGTCCACGCGCGCGGGGGCGCTCCGAGCGCTGCGCTACGCCATCAGCAGTAATGGCAGCATCAAGCACTTTGTGGACC
TCGTACGGCTGCCTCCTGCTGCTTTAAATATTGCAGAGAAGTTAATAGTTGTGTGTTTCAATTGCAGAATCTGCCGGTGTTTGTGGTGCGGTCGCTGGAG
CGAGAGCAGAAACACTTGGCGGAGAGAGTTCAAGCGCTCAAGGTGGTGCGACGCGTGATGGAGATCGATGCGGCGCAGATGCCGACGGGTCTCGTGGCGT
CGTTGACGGCCGTTGCTGGACACAAGGACGACAATATGCGTCGAGTGTGTCTGGAGACACTGAGAGAGCTGGCGCTGCTGAACGTGGAGGTTGTGGCGGA
GGCGAACGGCACGAAGGTTCTGGTGGATGCGATTCTGGAGCCATCATTCCAGGATCTGGCCGACTCGCTGCTGATGACGCTGCTGCTCATTCTGAACGAG
CCGTCGACGCGCAAGTTTATCGAGCCTTTCGTGGATTCGCATGTACTGTTGGCGCCATTTACAGATACGGATCTGCCAGCAGGTAATGAGCGGCGACAGC
GGTGGATGGCCAGTCGTAACGCCATCGTGACGATGATGCGCTCGTGGACAGGCATGGTGGTGCTCACGAGTAACCCGCAGGGCTTGCACTCCTTGATTCA
GTTATTGGTGCGACCGGTGGGCGAGGATGTCCAGAAAGCAGTACTGTCAACAATTTGTGAGATCTTTTACAAGAAGACAAGCTTCGACAAGTCCGCGACC
GATGCAGCAGACACACCGGCACTCCCTATTACTCTGTCGAGCGCAGAGCAACTGCCCCTTGCAGTCAACCACAATTTGCTGGACAACTACACTGTAATTA
TTCTGCTGGCCATGATTCACTGTGGCATCCTGGAGGCTCTGGTGACTCTAGGTGCGGGTCCGTCTCGAGCATTGGCAGAGCCGGCAATTGACCTGCTGGC
CGATATTCTGCGTATGGCCTCGCGCCTGCTGCCGGACCAACACTGCGCGTCTTTGCTTGCGCTCCCCCGCCTAGTTTCGGCAACTTCGCTTACAACGACC
ACCACAATGACCCTGGGAGATCACGCTAAAAGTCTTTTGGAGCGTCTTCAGCGTGAAAAGTCAATTCGGGCTAGTGAAATGCTGGGTGAGCTCGCTAACG
CTGTCGGGGCCAATTCAGGTAGCATTGCTACCCGTGGTGTGTCGCTAGTCTCGTACGGTGGCAGCGGTGTTAATGGTGTTCAGCTAGCGTCCGAACTACT
TCGCGACACTAACCGACCATCGAACCTTCTCGCTCTCAGCAGATTGCAGGTGTGGTGCGTCTCCCATCATCTAGCGGCGGAGGTGGCCTTGGAGGAACTG
GCAGTAATTCTGCCAACTATGCTGTGGCAGCCCCTCAACACAACGTGGCACTAAGAGCGCGACAGCGCTACTAAAGGACAGCTTGACATCTCGAGAGCTG
ATGGTCCTCGAGCTGAAGCAGTCATTGGATGCACAAATGGATGACAGCACATTTAAGGACATGCTGCACAACCGTTCACGGGTGCTGACGGACAAAAACT
ACAAGAACTGGAACTGGGATATCATTTCGGAGATGCTTGAAGGTCCACTTACAAACCCGCAGCGACTCTCAGAGGCGATGAAAACCAAGTTCTTTAAGCG
CCTTTCAGGTTTCTTCCGTTGCGACCAAGGCAACAAAGGATACTTTTCGAATCTGTACTGGATCCAGACCACGTTCCCTACCTGCGCCCAGCGTGCCAGA
TGTACACGCTGCTGTTAAACCACCCCGAAGGCTTGCTCTTCCTGAAAACTGATCGTCGTGGTCAATTGCTCACTGAAATTTCGTCTGCACTAGAGCTGGA
GGCACGTCCTGAGGCTGCTATTGTGGAGTCCCATATTGGCGTGCTAAAGGCGCGCATGTTCTCTCCTGATTATGTATCGCGGCGTATGCTACGCGAGTAC
TTCACACTTTTGGGACTGATGAGCTCAAGCAAAGAAGGTCTCAAGATGATGGAACAGTCAAACCTGTTCCAGCGGCTCTACGTCATGGGCACCACAAAGG
GACACGATTTCTTGTGTCGCCTCATTCTTGCCAACCTGGACTACTCTGTTGATGGAAGTTCCCGCAAGTTGCTTCAGTCTTGGATGATGGAAGGTTCGAA
GGCGCTGCGTCTGTATGCAACGTGTTTGCTGCGTGCGTTGCTGCGCCTGAGGTGGCCGATTTTGATAAGTGGGGCATTGATGCGCTGGTGACTCAGCTCA
CACAGGAAGAGGAGGTTGCCAAGGCCGCACTGAGTGTACTTGAAGAGGCCGCTGAGACGCCCGCATGCCTTCTGGCGATGATTCTGAAGCGGCCTATGAA
GCTCATTCAGCTCAAGGATAAACGAGCAGAGTCGCTGCTTTTGAAGTCGCTCTCGCTTCCTGAAGGTCTGAACTTCCTGCGCGACACAGGCGATTGGATT
CGGCGCACTCTAGCCGCCTGGCGTCGCGAAAAACATATCTCGTACGTCCATGCGGTGGAGCACGCGCTCTTCCGTGGTTTGCACCGCGATGCAGCGGGGC
GTGAGCGTGGTTCGAACAGTGGTTCAATAAATGCACGCCAGACGTGCTCTCCCACTCCTATCCCGGTGAATGTGCCCATGAAGCGAGGTGGCGGTGTTGG
GCTCAAACCGCCTAGTGGTGGAAGCAGCCAGCGATCACTATGGGGACTGGATTGGCTTTACCGTATGCCGTGGAACATGGAGGTGAAGATTGTCGGGCCT
CCAGGAAGCGGGCCTCCCTCGAGCCTCATCTTGGAAACGTATATTGATGGTGCTATGCGCGACGAGGATGAGACGACTGGCATCGATGACGAGCTTCGCA
TGAACTCGATTCGTGTCAAGGGTATCGTTGTGGACGCACGCAACATGCCACAACCTGTGGTTGTGAACTCGCAACAAACATTACAAGCTTGTCTTTTCCT
GGGTACGCAACCCGTAGATCGGCGGGGTTTCACAAAGCCTCCCCCGCAAAGTAATGGAGGCTTCGTGTCCACAAGCGGATCAGCCAGTGGTGGAGGCTCG
GGTGCTCTTTCGAGTGATACGCAGCAGAAAATGCTACGAGCGCGGTCAGCGTCAAACTCAGCAGGAGGAAGCATGGATCGCTCCTCGGAGACAATGATGT
CGTCGCTTGACTTCGCTGACACTGGGTCGTCTTCGTCTGAGGCAGCAAAAGAAGAGAACAAAGATTGGAGCTCGTGCCAACCTGAACAGCGCTCACCACA
GTACTTGTCGGCACCAGAATGCTCGCTCTGTGCTCCAGGTGAGCGTGCGGTGTGGAACTTCCGTGTGGAAATGGACTCCGCGGCAGGCAGCAACACTTCA
AATGGCAGTGTGAAGCGTCTTATGCTCAAGTCTGTCGAGTTCACGTTGCAATTACTTCCTCTTCGTCCACGTACTGTGCCGCTGCCGGTACACTTGTACG
GTGAACTGGCAAAAACCAGCGCTGGCTGCCAGATCCTGCACGCATCTGGGCACCTACCGGAGTTCCTTGCGTGCCTACGCGATGCTGCTAGTGTCCCGCT
TGAGAAGCGTGCTGCATTGTGGGCGCTCGGCCATGTGTCTGCCACACCGCGCGGCTACGATCTTTTAAACCACTACGCACAAGATTTTGTGGAGATGATT
GTCAAATTGGCTACGGACTCTCCGCTGGTGTCGATTCGTGGTACTTGTTTCTTCGTACTGGGATTACTCGCGCGATCACCCGCAGGACGGCGACACCTTG
CACGTTTGGGCTGGGATGCCCCACGGGATGCATCGCGTACATCCATTGCAGTCCCGCAGAACTGCACATCTCTCTTCATGTGGCCGCCGTCTGGACCATC
GAACCCATGCCCATTGACACAGACACCGCGAGCGTCGCCCCTACAACGATTGCTGGTGCGCAGGCGCGACAAGATACCCAACGATTGGCGTGAAGTGCTG
CGTTTTGTCGCGGACCTGAGTAACCACATCACGCAGAAAGGAGGCCCATGCTTCGCTCAACAAACTCCGTTCATCGAAATCCGAGCTGTTTGAAGAGCCG
GTGCTGCTGATGTACGTGCACGCGCTACTGGAGAAGTACAGCTACCGATTGGCTTTACGCCAGTTTGTGCTCAACGCGTTCGACCGAGCAACACTGACGG
ATGAGGTGCTTGACACGCTTCGAGTCGAAGACGAAGAGGAGCAGGGGAACCAAACGCGTACTGGCCAGCGTGTACCCTCCGGGCGGGAGCTGCGGCGGCG
TCGCTCGTCGCCGTCGATCCCTTCATTTACGGCTTCGGTCCAGTCGCTCAACTCTGCCATGCAGGCAACGTCTGGTGTGTCGCGCATGTCGTCCATGCAG
AACGTCCTCAACGGTGGCAATATGGGCGACCACCGTTCCACGATGCGTTTGAACGCGCACAATGACCCCATCGATCGCACTGTGCTGCTCAAACGTAGCC
GCAAGCGCTCTGCCTTCTCAGAGAAGACCATTGTGTCGGCGCACCTGAAGCTGCTGTGTAGGTTAGGCTAAGATATACCTAGACGATGAGCTTGGCGTAG
CGTTTGCCAGTCGTTATTCTTTGGTGCACTATCTCTATTGGATTTACCTACAAAACCTCCCAGAGGCCATGTCCATGAGCGAGTCACCCATGTGGAGAAC
ATCGAGCTTGCACAGCTTCCCGTCCAGAGCAGTGCACATGGTGATGGCACCTCTCAGTGTCTCCAGGCCGCTCCGTTGCACGCGCAGCAACGCCGTGCTG
GGCTCTTTGCTGTTGGCAGCTAATTTATCAAATGATAGGATGTCGAACTCACACGCCGAGGCGCCTACCACGCCGAACGCCGTCTTGAGAGTGTTGTCCA
GGGCGAATTTCAGGCGCTTCACGTCGCCCACAGGCACCGATCCGTCCTCGGAGAAGCTGGGAATAGAGATCAATATAAATTAGGTACTGGTATATATCTA
GTGATCTCTAATAATCCGTAATGGGACGTACATGGCGATTTTGAGGTAGCAGTGCTGGCCCTGCAGCGAGAACTTGTGGTGCGGCGCCGACGCAGGTGCC
GCCATTG