Description :
From Genome Similarity Track
Location :
contig_24:170254- 171413
Transcript NameFunction/comments
g4536.t1Cyclic AMP receptor protein A

Sequence
1159 bases(100 bases per row)
TCATGCAAAACTTTGTCCCCATCTCTTTGAACGTCTCGCTGGAGTTCGTCAAGTATTGGCAAGCCTACTTTATAGAGCAGGACCTGGAGATGTACGACAA
GCAATCCGATACTCCTGCAATGGTGCGATCATCAGCTCTCAACGAAGATTTAGGCCGCGTGCATCATGTCTTTACGGACAAAACCGGCACGCTCACGATG
AATCTTATGCTCTTTCGTTACTGTATGGTTGGAGGACGACATTACGGTGGTCTGATGCAAGACAACGATATGGTAGCGGAGGAGGCCAACGAGCCTTCAT
CTCCCTCGATGGCTGCCATAAATGATGGCCCACGATTTGTTGACTTCGACCCAAGCGAGCTGTTTGCCGACATTCAGGCAGGAGGAGAGCAGGCGCAAAC
TCTTCGTCGATTTTTACGGCACTTGGCAGTTTGCCATACGTTGATCCCGACCAAATCGTTTGCTGAAATGTGCAGTACGTCTTTCCCAGAGTACTCTGCG
TCATCGCCCGATGAACAGGCACTAGTTTCTGCAGCGGCCTTCTGTAATGTGCGCTTTGTGCACAGAACACCCACTACCATGATGGTCATGGAGCCAGGTT
GGGCAACTCCTAACACATACAAACTGCTAAATGTGCTGGAATTTGACAGCGACCGAAAGCGCATGACGGTAATTGTAGAGGCCCCCGATGGTGCGATTGA
ACTCCTTTGCAAAGGCGCGGACAATGTCATTTTTGAGCGTCTTGCAGCGGATCAAGCGACTTTGCCTGGTGGTATGTCTAGCGAACAAGCAGCTGAACAA
CTCACGCTGTACGCGAAGGCTGGTATGCGCACGCTCTGCCTCGCTTATAAAACGATCGGCAGATCTGAGTACGAGACATGGAGTGCCCGTTATACGCAGG
CGCATGGTTCGATGGAGGAATTAGTAAAACGACGTCAAGGCCGTGCAAATGCGATTGACCCGCTGATGAACGAGATTGAACGTGATCTTATCCTACTTGG
GGTCACTGCGGTCCAAGATAAACTCCAAGCTGGGGTGCCTGCAACACTTCGGCTCCTGCAAGAGACCAACATAAAGGTTTGGACACTCACAGGTGACAAA
ATGGAGACTGCTGTGAATATTGGGTATGCCAGCGCGCTGCTTTCTCACGATATGAATCT