Description :
From Genome Similarity Track
Location :
Scaffold_727:1702- 6315
Sequence
4613 bases(100 bases per row)
CCCGTTACACCTGGTAGCACTTCGTAGTCCGTTTAACGACCATGAATATGTTGGACGATGAGGGGGATGATTTTCATCCCACGCATGAAAGCTACTCCCA
TTTGAGTCAAATCGAATGGGACGCTGTCGAACGTTCAACCATAGGGCAAGAAGCCGTTGGCGCACTGCTGTCCGCCCTGGGGCCAGACGGACAGCACGCC
ACCATCGCCAAGTTCATTCAGAATGAACTTGACGTCGAGCGGGAAAAAGTAACCTTGCTTCACCAACAAGGTTCTCAGCAGACAGAGCTGTTGAGACAGC
AGCAGGCCACTGCTACCGGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCTTGGACTACCGTGGCTCAGAAGGTACGAGCCACAAGTCAGCTGGCATCA
CAAACAGTCGATATGCTGTCACTGTCATCAGATGGCCATCTGATGAACGCCATGGAGCGCCCACTAACATGTAGGTGTACTACGAGCGAGTGCGATGGCC
TCGCGTGTGGTTCGATCGTTAGTACGACTGCACGTGGCCATGACGTGGCTGATCGCCATACCATGGAGCCAGATTCCGGCGGCTGCATTGAGATGCAGGT
TGCGCCGAAGGCCCACCACCCGAATAAGTCGATTGGACTGGGGCGTGGGTGTTCTCCAAACGGACAAAACCCAAGTGACAACGAACCGTTCGCCAATGAT
TGGAAATACGATGATATTAGTGCGATTGGAGGATCTCACGTAGAAGACATGGCCGCGGTAGCGCAACCACCACCAGAGGATAACGAGGGAGCAATTCCAC
TCGTGTCAGATGATAAGATAGCCCAAGAGGCTAGTGAGGGAATAAGTCCCCACCGAACTGTGGAAATAAGTTCCCAGGAGACAACAGAGACATTAAATGT
CCTAGTCAATGACGGATCAAGTATAGGAACTTACCAACTTGATCTGATCGCGCCTCCGAATACAACTTCGGAGATCACTCAATTTCCCACGCTCGAACAG
AAGAGGTTCTTGCGTGATCTGCGTAGTGGCAAAGTCAAGCAGATTTGCGTACTCGTCGCGGAAGACGAGTCCGTAACCGATATTCGGTCGGCAATGGTAT
TCGCTGAGAACGAAAGGGTTCTCACCAGCTCATCAATGGACGAGAGTGTCCTTGATGAAAAGACTCGGATTGAGCTATACACACCCCAATCGTGGGAATC
GCTCGAGACAATTCCTCTCTACGATGATTTGACGGAATTCAGGGATGTGATCCCAGAAACAGTGCCGTACCCAAGGATAAGAGTACTCGTCACGAGATAG
ACCTGAAACCAGAGTCAAAATATTGTGTCATGAAGCAATGGACATTGCCTCGTGAACAATTACTAGCGTTGACAAATTCTTTGCCGATCGCTTGGCAGCG
GGCCATGTGAGGGAATCTACTTCCCCACATAGCTCTCCGACCTTCTGTGTGCGAAAGGCTACAGAAAGATGGCGGATAGTACATGCCTTCAACAAGTTGA
ATGCTGCAACTATACCGGCTCAAACGCCGATACCAAGAAAGGATGTCATTAAAGATGATATGGCAAGGAGTACCATCTTTTCATCAATGGATCTGATGAA
CGGGTTCTATTAGATCCTTGTGCGTGAAAGGGAAATCCCGTACACTGCAGTGAGCGCCCCAATAGGTATGCTTTGGGAGTGGTGTGATGCCACAAGGGCT
GAGTAATGCCCCTGCTACATTTAACAGATGCGTTACGAATCTGTTGAGATCGCGAGAATTCGCACCTAGCTATTTTGATGACGTGTTCGTCCATAGACGG
GCTATAGATGGACAGACGGATTTGGAAGTCCACCGGCTCCACGTCCGAAAGGTTCTTGCACTGATGCGTAAGCATTAGTTGTATGCCAACCTCGAGAAGT
GCATATTTGCTGCTAGCAGAATACCACTTCTTGGATGCATCGTGGGTAAGCACGGCGTCCGGCCAGATCCGGAAAAGATCAAGGAGATCACTGACTGGCC
GGTGCCTACCGACATAAAAGGACTTCGAAAGTTCCTTGATCTAGCAGCGTATTTGAACAAATACTCGCACAATTACGCCGAGATGACTGTTCATCTCTCT
CGTTTATTGAAAAAGAACGAGAAGTGGGCATGGAGTGCTCATTGCCAGCGCTTCCTTCGAAGGTATCAAGCAAAGCTTGATACGCTCGCCAGTTTTGGCA
ATTGCAGACCAAGACAGACCACCTCATGTGGTCTGCTATGCAAGTTATTTTGCCATCGGATGTGCACTGATGCAGTGTGACGCAGACGGTGCTGAGAGTG
TCGTCTGCTATCAGTCACGTCAGCTGCAACCGGCTGAAGTAACTACCCGGTCCATGATAAGGAACTCCTTGCCATGAAGTATGCTTTGGCAAAGTTCAGG
GTCTACCTGCTAGGCGATAGACCCTTCATCGATTACACGGACGATGCATCCTTTCGCACGGCCGTTAACAGTCCACAGTTCACGCAACGAATGACAAGGT
GGCTGTTGTTATTCGCGAAGTATAACTTCTCGGTGGAATATAAGCCATGACGATTGAATGTCGTCGCTGATGCACTGTCGCGCCGGCCCAATTTCGAACC
GGCTGCGCAACCCGACACTGGTCCGACCACTGTCGCGGTGTTGAAGTCAAGTGTCCCGTCGTCAACCATATTAGAAAATATACGCAAGGCGTACGATCCG
GTGATGGTGTGTTTGATGGATCATCTCTCGCAACCATCCCGTCAATCCCTTAAAAGGTTGCCCCCAGTATATCGACCCTCCATGGATAGATATACAGTCC
ACAATGGCTTACTGAAGTATTCAGTCATTGCCGGCGACACACCTCGTGTCGTCGTACCGGACCATGGTGACCTGCGACTGCGTGTCATGTACGAATATCT
CGATCCACCTACTTGTGGACATTGTGGTCGAGAGAAGTCATATCTCACAGTTAGTCGCGACTTTTACTGGCCCCGCCAGTATCAGTTCGTGCGAAAGTAC
GTCCGCGCATGCGAAGTATGTTAACGAGTAAAGTCTGCGCCGCTGCAACCCTTGCCCATTCCGGCGGGATACTGGACCTGTCTCATGACTTTGACTTTGG
ATTTCCCGCAGAC