Description :
From Genome Similarity Track
Location :
Scaffold_377:1702- 5735
Sequence
4033 bases(100 bases per row)
TGCTGACGCGTGTCTTTGTAGGAAAATAATACTGTTCGTTATTAACCTTTTAGGAGCTAGAAGTACGCTTATACTNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTATAC
TTCTCTGTATCTCAGGTTTTGTTACGTTGTTCGCTCCCCGCCATCCATTCTCTGTGCTTAAAGTGACCCACCTCAACTGCCAGCATGACCGCTGGTCATC
TATAGTGACTATGACCGCTGGTCACCGTCTGTGACCGCGACTGATGACTTGTCAACTTTCCACCGTACCGTTGGAGATTTTTAGCGGTCAGTCCCAAGGC
CGGCGTGACCAGTCCCACACGTACCCATGATGTGAAAAGATGCGATTATTCAGGATTTCTCCCGACCACTTCACCAAAGTCGTCTCCTGCTCCGATAATC
GGCAACCGATTCCGATCTGGGTGAGCACGTTTTCACTTACCTACTCCGTTCAATTCTTGCATCTTTAATCATATGATAAGCTTGGAGAGATGTCGCTTCC
AAACCTCCCCGCCGCTGGTCTAACGCTGGTATTGGGTTTAGCACCCCTTTCGCCGGCCCCGCTGCGATCATCCATCCCCGTTCTTGATAATGAAACACAT
GCTGGTCATGCAGTAGACGCGACCGGCGACACTCGTGCTCTCAATGATCTTGACTCGCCCCAAGTTGGCACACTCTCTGATGACCCCGGACAAGCTCCAA
CAGAACCCGGAAGCGCTGCGACTGACGTTCCCGTTGACTCGGCCGACGTGGCAGCTCCACCCGTTGCTGTCTCCGTGGACTTTGGCTTGCATAGCAGTGG
CATGATGGCCATAGAGCAAGCACCCACCTTGTCGGAACCGAAGCTGTTCCAGCTGTTCCATCTGATCACCCTGTCGACCCGGTCGGCTTTACTACCGTGT
CTGTTGACGTTCCCGTGGGCTTTGACTCACCTACCGCCGTGTCGGTTAACATTCCCGTTGAGTTTGGCTCACCTCGCAGTGACGAGGTAGCCGAAAATCA
AGCATACAACCCCGGCGAAACCGAAGACTTTCCTGCTGATCACCTTGTCGACCCTGCAACGATGTCTGCTGACGTCCCTGCTGCCCTTGAATCACCTTGT
GTGAGCGAAGCAACTGGTGGTAAAGCATCTGACTTCGGCGTGACTGACGCCGCTGATGCCGATCGTCCCGTAGAGCCGGTTGACCTCCCAGCTGTGTCCG
CCGGCGTCCCCACTGACCTTGGTACGCCCCACGTTGGCGAACTGGCTGTCCAGCAAACACGCTGCAGTAACCGAAAACGGCCCTGATGATCCTGTCGTTG
ACTCAGGCGCTTCCAACGCGGAGAAGCCGAACGTTCCTGCTGACCGGCCCACCGATCCGGTCAACATCGTCGCTGTGATGCTGGTGATGGCGCCGATGTC
ATCATTCTTGATGACCCTGCTCCTCTCTCCGCCACCAGCTGTTGTCGTGTGGTGAAAAACCACGTACCTCCGGTTCTTATTTCCGACTCGCGAGTAGGAC
CTCCGTTATCCGACGACGACAGCTCTGTGGGGAATCTGATCACTTCCTTGTACCAGCGTATCGCTTTCCAAGTGGACTGGGTCACCTCGTACCAGGACGT
GGAAACAGTCCTGCGGATCTAAAAGCAATGTGGAGACGAGCTTGAGCAAGAACTTCGGGGTTGGATCAAGATAGCGTGCCCGTTCGTGCAGTTTGCTCAA
TACAAGTATGAGCGTTCCCGTGCGGCGTGGCGTGAATGCCATGTAAAAGCCGATCGACTGGTCCAAGAGTGCTACGACTTGCAGTGAGCGGTGGACGAAG
GTGAGGGGCGCTTGGCTCCGCTCCGGACGGGGTACGACTTTCTTGCTCGCAGTGTGGCTGAACAAGCTCGCGAGATTGACCGTCTGAAGACTGAACACGC
ACTTCTTGACTAGGAGGTCAATCGTTTGCGCTCTTCCCACACCGCTTACATTTAGAACTGTCACTTTTGAGGGCCGAGCAGGATCTACTCCTCCATGATC
GTGACGCTCAGCTGCCTCATCTGGAGGCCTTTGTTATCGGGTTGCCACCGTCGGTGGGACTCGCATATGACAAGCGGCGGATGAAGCAATCGGTATTCGA
TCTCGTCCCGCCCCTAAACAAGCGTCCGCGCGTCGCTGTTCATCCGAGTTTGCCTCCTGGAGCTCCCCCCCACTGTCGCACAGCCTGCCGACCAAGCTAC
CCAACGACGGTTGGCTTCGGATCACTCCATGACCCAGCAGACCTCGCGTCCTCGCATCGACGTCCAAGAAACTCCGACCCCCACGACCTGGAGATCGTCC
AAGTCAAAGATAGCTATCACTCCTCGGTCGGTTATGACTAGGCGATCGCAGAAGCAGAAGCGAGTGAGTCCCCCATCTGCTTCTCCCGCCCTGGATAGCA
AAGATTCCGTTGGGTCTGTCGATGAGGCCATGCTTGCCACGATGTCCCAATCACGCTCTTTCGTACGCTGGCGGTCATCTGCCTCGACTGAGAAATCTAA
AAATGGCATGGCGTGCACTCCTATTGAGATCGACCCTACAAGCACCACGCCCGCTACTCGTTCGACATCTTCGATACCTGATACCCGCACTTCGTCGACC
ACCTCCGACCCAACGACGATAACTGGGACACCCCATGCGGACGAGCCACACGAGGCGTCCGACGACTCCGATGGGTCTATCAGTGTGTCAAGCGGCGGTC
ACGCCACGATGAATAAGCTATTCTCCACGACTGCTTACAAGGCCCTGCCCTTCGTGCGGTCATCGTGGGCTAAGTGGATACATGAGTATTGTGATCGTGC
GACTTATGACCCTGGCCTGTTTGCGTCGCAGTCGTCTCGCCGCTTGGGTTTAGTAACTGTGGGTGAACTGTACTTGGGCCTCTTGTTCCCTTACTACTAT
CGGCCCAAACACTACTTGTTTCCCGTTCCGGAACCTCGCGCTCGCCCGCTATCGAGTCCCGATGGTCCCCACGACTGCTGACCTCGGCGCAAATCGCCAC
TTTATACAATCAGAGACCATGGGACATCCTGGATCAACCTATCGCGCCTGTGTTTTTTCGCCCGACCGACTGGTTTCAAACCTCGGTGATGTGATGGACC
GGGTTCTCAAAACTGCTTGTTGAGCCCCCAAAATACCCACTGCGCCGGACTGCCGACTTGCAGGGGTACCCCAATTCCGCGTATGTACTTTGACTTACCT
TGTGTACCCGTCGACCAGAGGGTTGCACTCTTC