Description :
From Genome Similarity Track
Location :
Scaffold_2335:1702- 5266
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2335-snap-gene-0.339S ribosomal protein L24, mitochondrial
Pytiw_DAOMBR242034maker-piw_contig_2335-snap-gene-0.6Hydrolase, carbon-nitrogen family protein

Sequence
3564 bases(100 bases per row)
ACTACAGCAACGTGAACTTAGTGGACCCGTCTATCGGGTACGTCCTTTGTATTCATTCCACAATGGAGATCTCGGCTCGTAGTACTGGTTGCTAATTTAC
AAGGTACTATTTACTTTTTCGCGACCACAGCAAGCCGACGCGCGTGGCAATCCGCTTCACGGACGAGGGCGAGAAGGTGCGCGTGTCCAAGAAGACCGGC
ACGATCATTCCCAAGCCAGAGATCCTCAAGGAGCGCCACAACCCGCGGCGAACAGAGACGGGCGTGTTCGACACGGCCCCAGAAGACGTGCTCGAGCGCA
CGGTGCAGGACTGGGAGGTCACGCGCTTGTAGGCGGCAGAACCGGTAGACACGGCGAGGAGGCATTGATGCAGCTCAGTCCATCATGCGAGCTGGCGACG
AAGACGGAGATCCAGAGGGTGCAGATGCCAGCAGCAGCAGCAGCTTAATACAGAAACAAGATAGCCAAGAGCTACGTGGTATGTGCACATTGAGATGTCT
TGTTGTGTGATCTCGAAGAGAGCAAGATAACGACAACACCTTCAGAGGCAGCACTCACGACGATCGAGTCCACAAATAGCGATTTTGCGATATTTTTAGA
TCAAATGCGGACTGCTCATTGGCTTAAATAATTTTAGCACAATCTGATTGGTGGAAAGTATCGGATCCGCGGCCGTTGAGACGCAGAACGCGAAGCGACA
CCAGAACGACAAGATCGGGCCAGAAACGAGCGTCCAATGCGAGCGACGCAGCACGACCGCAGCGCGCCTATTGCGTCGCTGGCGTGAGGATCAGAAGCGC
AAGAAGAAGGAGAAGACGCGCAGCCGCATCAGGTGCGCAAGGACGAAACATCTGCTTCTTCTTCGTAGCTCTTCATCACCAGAAGCGCACTCTTCGATTC
GAGCCACACAGCGCACCCAAGTAGCCCAAGAGCTCAAGTTACAGTCAGTCTCAAAGATGGCCATGATCGAGGAAGCCCAGGCGCTGACCGCAGACGACCA
GCAGTACTACGACGCGCTCACGACTGAGTACGGCGACGCGTGCACCGAGGACTTCAAGGTGCGCATGGCGCGCGCGTTCCAGTCACACAAGAAGAACCGC
ATGCAAGTGACGATGACCGAGGCCAAGCGCATTCTCACGTGGCGCGCAGCGCACGGCGCTGACACGATTCTCACGCGCGAGCTCGACCACAGCAAGGTCT
ACTTTGACTGCTGGCCCGGACAGCTCTACGGCGAGGACAAGGAGGGTCACCTGATTGCGGTCGACCGCATCGCGGACATCCAGATCGAGGCTTTTCAGAA
GCACTTTGGCCACATCGACCAGCTGCTGCCGCACCGTGTGCAGTACATGGAGCGCATCCAGTGGGAGAAAGCCGCGGTCTCCAAGCGCCTCGACCACCGC
GTGTACAAGCACATCTGCATCGTAGACCTCAAGGGTCTCGGCATGAAGCACGTCTCGCGCTCGATCATCAACTATTTAAAGGTGCGTACGTGGTGCTACT
CTTGCCATGGTGCTGGTTGTGCTAACAGTAGTCATCCATCTTGCACACACACACACAGCCCATCTTTGACATTGGGCAGCTCTACTACCCGGAGACGCTG
CACCGCCTGTATCTGATCAACGCGCCGTTCGTGTTCTACGGCGCGTGGAAGATGATCGCGGGCCTGATCGACCCCGAGACGCGCGAGAAGATCCAGGTCT
TCAAGGAGGGCGACAAGTTCCTCGAGACAGCGCAGAACCACGGTATCCCGCTCGACTCGCTCCCGTTGTATCTGGGCGGCAACCACACGGGTCGTCCGAT
GAACAGCACGTTCAAGCCCTCGGTAGCCGACACGCCACTGCCCGTGCCGCAGCAGCAAGCGGCCATCACGTCGGTGAGTTCACCATGAAATTGGTTTACT
TGGTGGGATTTCTGCCTAACAATGTTGGACATTTTCTTGTAGACTGATGGCGAGAAGACCATGGAGTCCACGCAGATCCAGGGCGTCCCACTGAGCACTG
TTAGCGCGACATCCTAAAGCAGCTCGGCCGTCAGCTTCTTCACTTCCTAAATGCTTATATATTACTCGATAGATGATTCATTCTCCATGGCTCAGATTGA
CACAGCCACGGCAAAACTAAGACAGTTCCTTACTTCTGGACCAGCTCGTACAAGTCCGTGCGCGTCTGCAAGCCCATGGGAATGAAGTGACGCACCTCCT
CGACGGTGTTGAGGTCGATCTCGGCGTACACGATCGCCTCGTCATGCCCACAAGTCGCAACAATTTCGCCCCAAGGGGAGGTGATGGACGAGTGGCCCCA
AGCCTGGTAGCCGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNTGACGTTGCCGGCCGAGAGCGTGTCGGACTCCTTGAACGTCATCCTGACGAGCACGTCAATGTCGAACAGGTGCACCTTGCGGTGC
TTGCCGAGGATCTCGCCCTCGAGCGAGAAGATCACGCTCGTGTTGTAGATGCGGCCGTTGTCCTTCTCTGGGATCGAGCCGCCGACGAGGTAGATCTGGT
GCTGGCGCGCGAGCTGCGAGAGCGCGAACGTGGACGAGTGCTCGGCTTCGAGCAACAGCGCCTTGGTCGCTGGGATCTCTTCGGCGTACACTGGAAACGA
CGCCGTAGCGTACGGCGAGTTCCAGCATTCCGGGAGAGACACGACCTGCGCGCCGTGCGCGACAGCCTCAGCGACGGCGGCCCCAGCGGTTGCGATGTTC
GTGAACTTGTCGCCGCCTACGGCGATCTAACAGAGCGCGATTTGGAACTTGGGCGACTTGGAGGAGCTCATGCTGCTGATGGGGGCAAAGCGGGAGTGGC
AAGCTGTGCAAGCAGCAAAGGGGCATGTTAAACGACCCGCTGGGTCGTTTGCGCAAATGCTGGAGTTGAAGTTTGCTGAAGAAGTTTATCTGCATGGTCC
TCTTCCATGCGACTTGATTACTCGTTGCCCACTGGTCCGTGGCGATGTGTAGTTCTGTGCGGCGTGCATCTGTCTCGTCAACGACAGTGGATACTTGGGG
CGTGCATGCCTCATGGCATATCCTGTATAACTTGTCTGAATCACACGTGCTGTGCTGTCTGTTTTTATTGTATGCTGTTAGACAATTATGTAGAAATGGG
CGTAGAGCTACGAATACAAGCAGCTCTGGCCAGGTCTGCTTACAACTTGGCTGCTGGCAGCTTG