Description :
From Genome Similarity Track
Location :
Scaffold_342:1702- 4490
Sequence
2788 bases(100 bases per row)
GGGCCATCCAGATCATCTGGGTCGAACTCATCATGGGAGTTGTCTCCCTCCACGGACTCCGTCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCA
CTTGTGGCACGGGCGCTCTCATACCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGTGTCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCC
TGTGGCCGTCTGGTCCACTGGCGAGACCGGATCCGTGAGGCGAGTACCTTGAGCCCGATCTGACGATAATCCCACTGGTTTCTTGTCGGATCTGGCTCGA
TCGTGGCTGGATTGTGTCAGATCACGCGTAGGGCTTACTGGATCCGGAGCCTTCGCGCTCACAGGGACTTCCTGTCCTCGGCTCCTCACCCGCGCTTCCA
GCATGGATGCCCCGGAGGGTCCTAAAACCATGCGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGATGCAGCTTG
GCTGACCCTCGGCGACGACACCGGATCCGTAGTGCGCGACCTTTCTCCGGTGCTGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGA
TCCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCCTTGACTGCCACCAACTTGT
TCGCCGTTTTCGTTGGTGCTCTCACCGGTTCTCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAA
AGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCTGACCAGCCAGACCTGGATCCAGCTTGGTCTTATTCCGACTCTGGAGCTTGCATCTTCTTCCGC
GTAGTCTTACTCGTTTTCGTCTTCTTTCTCGTTTCTTAGACTAGCGGGGTTGGGTTTAGGTACAGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACC
GTTTCGCCTTCACTTTTCCTTGTTTTGTTAGCAGGGGTCCCCGAGGGGACCTGGGGAGGACAGAGAGGTTTTTCTTCTAGATCCGGATCCGGATCCACCT
CTCTTCTGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACTTCCGACGACGCCTCTTC
CCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGAT
CAGCAAAATCTGCGAGATTGCTGGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGCCCCCCGATGATCCGTGTTCTGCTGAACTTTC
CTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTGGCGAGACGTGGGGAT
GGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGAATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATTCGTGG
ATCTGGGGCGTAGGGGTAGCCTGTGGGTGTGCCCCTTGCCTTTGCGTTTCCTTTACGTCGTACTTGCCCGCCTCCTGGGACGGGAGATCTTGAGAGTTGA
GACCTTCTAGGGTGTAACCGACCAAGTAGTAAATTCGGTTAACCTGTCGGATCTGCACAAGTAAAGGAAAAGCTCACTAGGTTGTAGGATCTGGCCAATG
TATTATCCAGTTATCACTACCAACACTAGATTCGCAATTCCCAACCTTCTCGGAGCTCGTACGGCCAATGTAGTTCCGGTTCTTGAGGGCAGGAAGGCAC
TTGCGTGTTATTGTGCAAATTGAAGACTGTAATGATACTTAAGCCTATACCTGCCTGGATGTCTACCTTCTGAATCTTTTACCTGTTAAATCCCTTANNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTT
TCGATGAGGTCCTCGCTGCGATACAACCTGTTCCTGACGCGCTGTCGGTATTACCAGAACGAGTTGCCGACTTGGAGCGTCAGTTGCGGTTTGCTCAGTC
CGAGGCTGCTGCCGCCGTACGTTCGGTGGCACCCCACATCATGGCCATTGAGAACGCGGAGACATTCCTCAAGGCTGCCAATGCTGAGATTGAAGCTTTA
CACCACAACATCAAGATTCTCCGCGAGTCGAACGCCAAGAACGACGCCATGCTCGCCACTGTTCAAGCCACTATGGAACGACACGCAGAAGACTTGAATC
GTCTGCACTGCGAGGTCCAAGCTCGGGACGTTTTTATCAGCACGTTGCAGAAGAAGCTGGCTCGCTAACGCGAAGTGTACAAGTCTTCTATTGGCGCGAA
TACTGAGCAGACCCGGAAGCTCCACCTCCTTCTGGTAAAGCTTGCCCAGGGCAAGTATGTCGATAACGATACGCTCAAGGTCCTCGAGAACCAGCAAGAC
CGTAACACTCGCCTCCTCCAAGCGAATCGTACCCTCCGTGCACACGTGAGTCTGGCAGGGATGGATCCCGAGGTACTTCGTCTGGCTGTCGAAGGTACGC
TCTTAATGTTGCTCCTTCCACCGTGTGTTCAGCAACTAACGTTCGTTCACAATCCTTCGTGATAGGTCTGACTGCGGGTGAGCTGGAC