Description :
From Genome Similarity Track
Location :
contig_30:170113- 171609
Transcript NameFunction/comments
g5300.t1hypothetical protein

Sequence
1496 bases(100 bases per row)
TAAAGCTGACGTCTGGCTTCTGGCTCACGTTCCTGGTCCCGCTCTTGCAGCCATTCCAATACGGTTGGTCCACATCCCAGCTGAACCTGAACACCTTCAA
CAATGAAGAGGAATGCAATGCTCGACCTGTAGTGGACGGCACCTGCATCATGTTTCCTGGACACCAGAAGGCCTCGTGGACTTTAGGTACGGCCAAGCTC
GTGGTTTCTGTGTGGAAGCCTTCTTACTGACTTGTGCTTGGTTGTGACTTGACCCAGCCGTTAACCTTTGGGTTATCGGTGGTATGTTCGGCAGTCTTTA
CTGCGGCCCCTCGCCCAGCGTCTGGGGCGTAAGAAAGTCTTCACGATAAATGCCATCGTCATGTTCATCGGCTCCGTGATCCAGACCACGTCCTTTGACA
TCGCCCAATTCATCGTCGGCCGCTTCATCGCGGGTCTCGCGTCAGGTGTTGCAACGGGTCTCGTCGGCAGCTACATTTCCGAGATTTCGCCACCGCACCT
CCAATCCGTGCTACATCTCGGTCTTCAAATCTCCTTTACCTTCGGACTGCTAATGGTCGTCGTTTTCTTTTTTTTCGCCGATACTGTCGCCGGATGGCGA
GTCATCGCGGGTTTCCCCGTGATCAATGCCCTCCTCTTCCTGGTCCTCGCACCAGGGACAATGCTAGAAAGCCCCGTTTGGTTATTGGCTCAAGACCGGC
GGGCCGAGGCAATGAAGGTGGTCTCGCGCATATATGGCCCCGACGGAGTTCAGCACGCTCTTCAATGGCTGGAAAAACCTACAAGTGACTCGGCGGACAG
CGCTTCGACAGAGCCAGAGGAGCAGGAAGAAACACTGAACGTGTGGGGCTTGATCACGTCTCGCAAGTACCGCAAGCCGCTGGTCATCGCCATCGGCGTG
GCATGCGCGCAGCAGATCACGGGCATCGACGCCATTTTCTTTTACTCGGCAACAATCTTCGCTCGCGGCGGCATCTCGGATGGCCGCATCGGGTCGGTGA
TTGACAACCTGCTCATGCTTCTGCCGGCTTTCGCGTTGATCCCGCTCACGCAGCACTTCGGCAACCGGAAGATGATGATTGGCAGTGCTACGGGCATGTT
CCTGAGTGCGACGGCTCTCACGATCGCGTACATTTGCGACGTACCGACGCTTTCGGTCGTGTTCACGGCCACGTTCACGCTATCGTTCGCGCTGGGCTGC
GGGCCGTTGATCTGGGGCGTCACGTCCGACCTCTTCCCTCCGTCGCAGCGACCCACGGGCGTGTCCATCTGCATCGCCATCAACTGGATCTGCAACCTAC
TAGTGGGCGTCGTGTTCCCTTACATGAACGACGGCCTCAAGGACTACTCGTTCGTGCCGTTCATGGTTGTGACGCTGCTGTACGTAGTCTTCTTCACCTG
CTGCATGCCGGAGACCATGGGCAAGACGTCGGGCGAGATCCAGGCGTGGTTCAGCGGCGAGAAGAGCGAGCCCGCGCACTCACAGCAGTAGGCAGT