Description :
From Genome Similarity Track
Location :
Scaffold_2834:1701- 2756
Sequence
1055 bases(100 bases per row)
CAACTTTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACGCAAAGGACAACACAAAGGCAAGGTAACACACCCGCAAGGCAACCCTACGGCCAGATCCA
CGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATACGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCATCC
CCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAAA
GTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGCAGATTTTGCTGATCC
CGCTACACCACAATGGTGCGCGTGCCCGGATCTTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGGAAG
AGGCGTCGTCGGAGGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAGAGAGAG
GTGGATCCGGATCCGGATCTAGAAGAGAAACCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACGCAAGTCAAGATCCGCTAACAA
AACAAGGGAAAGTGAAGGTGAAACGGTATGCATTTGCAGATTCACCGGTTAAGCCAACACCGTACCTAAACCCAAGCCCGCTAGTCGAAGAAACGAGAAA
GAAGACGAAAACGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCCGACAAGGATCTC
GAGTTTGTGTATCGCCACCAAGCTCTACGCGATTTTCTGCATCAAGATCCTGTCATGCGGATCCTGAATCCACGACAGATCGAAGATCCAAGGGAACCGG
TGAGAGCACCAACAGAAAACGGCGAACAAGTTGGTGGCATTCAAAGATCTATTAC