Description :
From Genome Similarity Track
Location :
Scaffold_317:17003- 20133
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_317-snap-gene-0.9Phospholipid-transporting ATPase

Sequence
3130 bases(100 bases per row)
AGCTTCGAGAAGTGTATTTCAACTATGCgCCAGGCAaCGCcGCCTTCGACAAGTGCACAAACGTGGTCGTGACGTCCAAGTACACGGTCGTGACGTTCCT
TTTCAAGTTCTTGTACGAGAGCTTCACCAAGGTGGCCAACTTTTTCTTCCTCGTGGTGTGTATCCTGCAGACGATCAAGGACATCTCCAACACCTATGGC
ATGCCGACCAATGCGCCTGTGCTCTTCTTCGTCATTTCCATCGACGCGTGTTTCGCGATCATGGAAGATATGCGACGCCACCGCTCGGACCATGAAGCCA
ACTCGGCCAAGTGTCATATCGTGCGCAACGGCACTGTCCACGATTGTCTCTGGTCTGACGTCAAGGTTGGAGATTTCcTaCAGATTCGCAACCGTGAAGT
TATTCCGGCAGATGTGCTGATCCTCGCGGTGTCGGAACCAGTTGGCGAAGCGGCCAGTGGAATCTGCTATGTTGAGACCAAGTcTTtGGATGGAGAGACC
AACCTCAAGCTCCGTCAGGCGATTCCGGCCACCATGAGTGTCCTCGTCAACCCACAGGAGTTGATGATGCTACGTGGCGTAGTCAAGTGCGAACAGCCAA
ACCCATACATCAACAAGTTCGCCGGGAAGGTGGAGGTCACTGTCGGTGAAGGATGTGGGGTCGAAGTGATGCCGCTCTCCGCTAAGAACGTCCTCCTTCG
TGGCTGTAACCTGCGCAACACTGACTGGGTTTATGGCCTCGTTCTGAACACGGGACCAGATACGAAGATCATGCAAAGTGCGAGTGCGGCGCCCTCCAAG
TGGAGTGATGTCATGCTGAGAATCAACAAGATGATCGGTGTGTTGTGTGCGCtCcTCTTCTGTATCTGCGCgcTCGCTGCCACCTTCTACGTGACTTGGC
AACACGAGATGGTCAAGAACACGTGGTACATCCCATCGGATGCTAACAAGTCTCGTTTCCAGGAGTTCATTCGGATGCTCTTCTACTACTTCCTGCTTCT
GTACCAGGTCATCCCGATTTCCCTTTATGTCTCAATGACCAGTGTCAAGTTTCTGCAGGCACGCTTTATTGCTTGGGACAAGTTGATGTACCACGAAGAC
ACCGATACCCCAGCAATTGTTCGAACGATGGAGTTGAATGAAGAACTCGGTCAGATCTCGTACGTGTTCAGCGACAAGACAGGTACTCTCACGTGCAACG
TCATGGAGTTCCGCAAGTGCTCAGTGAATGGCGTTTCGTACGGCTCGGGTATCACAGAGATCGGAAGGGCTGCGctGGTTCGAGCAGGAAGACCGATTCC
CCCGGAGCCTAAGCTGGAGAGTGGCCAAACGCGTATGCcTtATGTGAATTTCGTGGATCCAGGCTTCTTTGATGCAATGAAAGGTGGAAAAGGAGAGGAG
CAGAAGAGGCGGATTCTACAGTTCTTCGAGCATCTCGCAGTTTGCCACACAGTGATTCCTGAGCAACTCGAAAGTGGGGAGATTCGATTATCAGCATCTT
CTCCGGATGAACAAGCGCTCGTTGCAGGcGCTGCCTTCGTCGGATACAAGTTTGAAAGCCGCAGCGTAGGCCGTGCAACGATCAGTGTGTTTGGTGAGAA
GCAGACTTTCGAAGTACTCGAAGTTCTCGAGTTCAACAGCACTCGTAAGCGAATGTCGGTGGTTGTGCGCCGCCCAGATGGTGAGCTTCTCTTGTATTCC
AAGGGAGCTGATATGATGATCTACCAACGTCTCAAGGATGATCCTGCCATGGAACCAATCAAGAAAATCACTCGGCAGCACATGGAACAGTACGCTGATG
ACGGTCTTAGAACTCTCGCTTTGGCTGTGAAACCTCTGGATGAGAAATGGTACCAGCGTTGGAAGATGCGATTTGACGAAGCTCAAGGCAATGTGGTAGA
GATTGACAAGCGCAAAGACGGGAAACCAAACGCGATCGACGACTTGATGGAAGAGATCGAAGAAAACCTTGAGCTTATTGGAGCGACTGCGATTGAAGAT
AAGCTTCAAGATGGTGTCCCCAAGTGTCTTGAGCATCTTACCCAAGCAGGAATCAAGGTGTGGATGCTTACGGGTGACAAAGAAGAAACCGCGATCAATA
TCGGCTACGCTTGTTCGCTTCTTGACAACTCGATCCAGCAGGTCATCATCAACTGTACTACGTGcccTAGTGAAGACGcAATCCGTGCGCGCCTCAATaC
TGCAGCTCGTGAGTATATTGAGAAGAACAAGGCAGCTGACGTAAAACCGGAAaTCGCTCTTATCATCGACGGTGAAGCGcTTGAGTGGgCCTTGCGACCA
ACGACAGCTCCCCAACTTCTCGATTTTGCTAGGCTTTGCCGTGCAGTGATTTGTAACCGagTTTCTCCTGCCCAAAAGGccGAGATGGTATCTCTGGTGA
GAGACAATATCGGTGGAGCGcgcacattNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNcttctcgtgcacggtcg
atggAACTACATTCGCATATCAAAaCTCGTGTtGTACATGTTCTACAAGAACATTACTCTCGTTCTCGCCCAGTACTGGTACGGTTACCTCTCGGGTGCT
TCTGGATCCAAGATGTATTGGGAGCTCGGTGTCCAAGTGTACAATGTTCTGTTCACCGGTCTTCCCATCGTGGTTGTCGGCGTCATGGATAAGGATCTAC
CTGACCATTTCAGCATCGAGTTCCCAAAACTCTATCGCAAGGGGCCTGATCGTGCGTATTTCAACTACTTCACGTTCTTCCGATGGGTCGGTGCGGCTGT
GTTTGAATCTCTCGTCATCTTCATCGTGAT