Description :
From Genome Similarity Track
Location :
Scaffold_1963:1700- 2797
Sequence
1097 bases(100 bases per row)
GTACCGCTTAAGACGTCCACGTAGAGTGTCGGGTGCGTCGTCATTGATTTAGGCATACCGGTGGTGTACGACGCACCATGCCTGGCCAGGACTGCGTCCG
GTCCAATGAAGTGGTGCTTCAGTTTGTTGCGGCCGACAGAGCTGACAGTGGCTAGCGTTAGACCCCTCGTGTCTAATAGCACTAAGCCCCCACCTTAAAT
GCACTTAAGTTATCTCTTCCATGTTTGTCAGAGTACTCCTTCTGTCTGTCTTGAGCTGCTGCCATGGCATCGCGGACCCTGCTGATCACGCTCAGCTTGG
TATCCACAAATTATTCCACTTGTTTCCGCAACGAAACCGGTCTCACGTCGGAGACCTGGGAGGAAAGATCTTTTCGAGCCTCTCCCCAACATAGAATAGA
GGATGCAGTGTCTCCTCGAAGCGAGAGAGGCACTCTGTGGTGGCGGAAGCCATTCAGGTAGAATGGCGTGAACCCCGTGGACGCGTCCATCGCGTTGCTG
AGCGCAAACTCAACGACTGGAAGATGCGTCGACCACGTACGTGGTGCGTCCGCGCACACACTGCGCATAGAATCTTCGAGCACTCGATTGACGCGCTCTG
TCTGACCGTCTGCCTGAGGATCATCGGCAGTGGACATCTGCAGACGCGTTTCTAGTAAAGGGGACAGCGTTTTCCAGAACGTAGTCGTGAACCGGGGGTC
TCGGGTCCGAGACAATCGTCTCCGGGAGACCGTGATAGCGGAACACGCCAACGATGAACAACCCCGCGGTGTGTTCACCTGTGACGGTAACGGGTACTGG
AGCAAGATGTACCATCTTGCTCAGCCGACACACGAACAACAAAATCCCGGTGTTGCCGTGTCCGTCGGCGGGGAATCGAAAGATGAAGTCAAGACTCATC
GACTTCCAACAGTCAGCCGGAACGGGCAGGATCTGTAGTGGAGCCGAATCGTGCCCTGCGGGTTTGACCCGCTGACATGTTTCACATGTCTTCACGTATC
GTGCGACTCACTTGTACATGTGGGTCCATCAGAAGACCTGAGAGACCGACAAGAAGGTCTTCACGCGACCCAAGTGGCCGCTGGAGGGCGCGTCGTG