Description :
From Genome Similarity Track
Location :
Scaffold_3301:170- 2401
Sequence
2231 bases(100 bases per row)
TTCCTCCTGATCCACACCTCTCTTGTGGATTCGTCTTCTCTTTCTTTCCGACGTGACCAGCTCACATCAGTGATCCCCCTCCTCCTGGCTCACACTCTTC
CTGTGGGTCCTTCTTCATCCTATCATCGATATGACCGACTCACATCCATGGATCCCCTTCCTACTCTTCTTCATGAGACTGCATCACGCCGAATCGATTC
CGATTCGTACAATCCAGCAAGATATCATAGCGTAATGCTCCACAGTTCAGATCTGCCTCGTCTACCCAACTGGGTTCGTCATATCCACGCCAATACACCA
GAAATTCACGGTAAATTCGTCCGTATCAAGTTCGCTTCCCTGACCTCATATCGGTAATCTTCTCGACTTCGAACTCGTCGTCTTCGAGATCCACATTCCA
ACTATCTTCCGGTAGGAGGACTTCGTCGAAATCCACCCGGTCAGATTCATCCACCGAAAGACGGATCTGCGGCCGATCCGGATATTCTTTGACCAACTTC
AGCTTGGATACGTGTACCACAGGGAACAGGCGATATTCGGTACCTGCCGTTTCCAGCTTTACCGCATGTTCTCCAATCTTCTCGCTCACCCGGAACGGTC
TATGCCATAGATGGGCCAATTTGCGGTCGTACCTTCTTTCACTCGATCCAAGTAAAGCCACACCTGCGATCCCACTTGGATTTGATGTGGACGGGCATCT
TCGTTGTGTCGATCCGCTCGATCCTGTATCGCACTCCGCAGTCGTTCGTTCACCTGGGATCTAGCTTGCCGGTTGTATTTCTGGACTTGGTATCGCCATC
GCCTTGGATCTCGGTTCCTCTTCTTGGGGCTGCATACTGGGATGGCCGCTTCCAGGGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGGGTATC
ACCCCGGATCCTGTCTTGGGCGGTGTTTATCGCGAAGGGGAGTCGTTCTGCGTACTCATCCCAATCCCTCTGATCCAAATCCTGGACATACATCTTGAGT
GCTCTCGTGATTGTCTGCACCATGCGCTCGGCCGACCCGTTAGCTTGGGGACGATATGCCATGGTTGCTCGCTGTCGCTGCCCCAGGATCCGGTTGAATG
CTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGTCTAATCATTTCGCTAGCTCCATTTTCGGAAAACACACTCCTCGTACGATTCAGCAATGG
TTTGCGCAGTTCTAGACGCACTAGCTTTGGCAATCACATATCCGGTAAACAGGTCCACCCAAATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGCAA
CGAGGGGATATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGACATTCCCAGGTGACTCCCCTTCGATTGTGGGCCTGCCCTTGCCTGTCTCA
CAATCCACACACTCACCGACATATCGTTGTACGCTCTTGAATAGTCCTCTCCAGTGAAAACATTCCGGATCCGTTGGTAGGTCCGACCGATGCCCTGATG
TCCGCCTTCTAAACTAGCGTGGTAGTGGTGTAGGACATCCTGTTGTAAGGTTTCCGGCATCATCAATCTCATCAATCCATCCCGATCCTCGTGGACTCTC
TTCGTAGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACTGCGTAATCCGTAGCAATAACGCTGTAGGATTTGGCATCCTCCCGACTTAAGTCTCGTA
CACCCCCCATCAGATACTTCTTTAGTCCCAGGATCCACGCTTCCTCGTTCTGTGCTTTGAGGATCCACTCAATGCGGACTCTCTTCACGAATGTTTCATC
GAGGATCTGAGGGCTGGATCCAATCCTTCCTCTGGACCTAGTGACAGCCATTACCTTGACTGTTCTTTTCCCGGATCCAACCACCACCACCTCATCTAGT
CGATTTAACGTAACGAGATCCTGATGCTCGGCCTCTCTCTCCACTTCGACACCACATTGATTCCGTAAAGCGGCACTGGCCAAGCTATCCGCACTAGCAT
TCCAATCTCGCTTGACATGCACCAACTCGTGATTCATCCAACCACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTC
AATCTCACCTCGCACCTGTCTGATTACCAAATTTGAATCCCCACAAATCACCAGCCGTTTTGGAGCTTGTCCCTTTAGTAAGTCCAAATCCAGAAGGAGT
CCGTTATACTCCGCTTCATTGACGGTGAGAT