Description :
From Genome Similarity Track
Location :
Scaffold_3202:170- 2026
Sequence
1856 bases(100 bases per row)
caggAGCATGACGAAGTGTATAAACCGGTAACATTCGCCAGTCGCACGTTGAAGCCTAATGAGCTCAACCACGGGATCATGGACAAAGCAGTGTTGGCAC
TGCTCAGGATGCTAGATGTCTGTTACACCCAACAGGTGACACGGTCAAACAAGGTGCTAACTCAGCATTCCACGTTGGCCTGGATGATTCACTCTTCGGT
CCTGCAACGGTGATTGGGCAGGTGAGCCGCGCATCATTCCAACTGGACGTTGGAGATCGTCAAGCGCACGAAGGGTGATGATGGAATTTTGGGCGTGATA
GCTGCAAGCATAACTACCcgagaagacgtcgacgcgATCTTGAAGTCAATTGCACCTCGGAAAGAACCTCGACAAGTGATCTCGATGCCTCATCCTACAC
TGTACCCCGAATAAAAGTTACTTGTAGTGAACTTTGACGTATCAGGGCGTTTGAAGCGTGGTGGATGAGCGTATGTAGCGATTAGGTTGGGTCTGCCGGA
ATGAACGGTGATCTCGGCTGTGTCCGAGTGCACGATCGATCTTACGGCGAATGAGGAGGAGTACTCCTGTGTTTCGATCTCCATTCCAAATTAGATAGGG
GGCGTCTGATCATATGCGGAGATTCTAATTTAGTTAAAATTACTGCGTGATCAAGCGATGGAACGTCTGCGATCTAGGCTGACCACGAGTTCCTCCGCAT
GAATAGAGCCTGGAACCAAGTGCCGACCGACTAGCAAGTGCAGCTCTCCAACGTGAAGAAAGTGACGTGGTTACAACTGAGATCGAGCGCCAAGACCTAG
TGCCACTGAATCGACTGATCGAGTTGCTGGTTCCACAAACGAGGAATTCTGCTGTGAAGGTCTTGGCAGTAACCAGATCACGCAAGCGATGCAACCGTGA
AGTCTTGAGAGAGGAGATCGTCCATCCGTTGAGGGCAGAACGTCTTCTCCGAGCCCAAAACGAGGCAAAGTGGATTGTCAATTTCAAGAAGTACCTACAA
GGGAACGTACAAGTTCTCAGCTTCACGGAGGCAAAACAACTGTGCCAAGATCGCGGGGGACTATGAGATCGACGAAGATGGGTTACTATTCTTTTGCCCG
CCATCAATGCAGTCGTGTAAGGATCGTGATCTCATTGATTGTCTAGTCGTTCCAAAGACCATCAAGCACGTTTCCTGCACCACTACAACGTCAGCCTCGA
AGGAGGACACAAGGGGTCGGGAGAACGTCCCAACAACTGAGATGGCACTTCCATTGGAGGGGAGTGTACCAGAGTGTGCATCAATATGTAGATTGTGAGA
CGGGGAAAGGAATACCGGTCATCCGAGGAGAATCCCCTGGTAATCTGCAGGCGACCTACCCGTTTCAGATCGTCGCGATGGATCACATCCCATCGTTACC
GCGATGTTTTAACAGCAACACCGAGCTGTTGATCTGGGTCGATCGCTTTATCGAATTCGTGATCGCAAAAGCTAGCCGCGTCAAGGACAGCCCAGGCTAT
TGCTGAGAGTTGTGAAGAGTACGTTTTTCGGCGTTTCGGTGCAAGTGAAGCAATCCGCTATGATCGCGAACCCAGTTTTATGTCAGGCTTTTTTAGATCA
TTCAATAAGATCGTCGGCCAGAAACAGCGCAACGATGGCGTATCACCCACAAGCCAACGTCAAGTCCGAGCGGAtggtgcagacgctgacTCGCGCTAAA
GATGTAGGTCGCTGAAGTAGATGAGAAGGACTGGGATAAGTACAAGGAACGTCTTACGTTCGCCATTAACACCGCTCAAGATTGCGTACGTGGAGATACG
CCCTTCTATCTGGTACATGGTTGGGATCCACAATCTACACTGGAAGCGATGATACC