Description :
From Genome Similarity Track
Location :
Scaffold_2350:170- 1996
Transcript NameFunction/comments
Phyag_g12375Amino Acid/Auxin Permease (AAAP) Family

Sequence
1826 bases(100 bases per row)
AACAATTAGTTCTCGTGCTCGGCCGTGTAGTTGTAGTACACGGTGTTCTCGAACTCCGGCGCGCAGAATGGGAAggccgcgtcgtcgtcgctcggaGCGA
ACAGGTTCTTGCCCGACGTATACGTGACGTAGCagcccaagcagaagcacaCGACGACCACAGTGAGTGCAGGGATCTTTTCCCACATCGGAAGCACAcc
ccacttcttcttcaacaagaaaacaatCGGCAAAAGAATGGAGTTCACGGTGATGCACGACGCGCCAACAAAGTCCGCCAGGTCCGAGAAGTGATCCTtc
agcacaacagcagcgatcACCAAGATCGTGATAATCACGATACGGAGAATGACATACTTGATCGCGTTGGCGCCACGGTACTCAGCGGCTTCCGCATCGG
GCTCATTCAAGTGCACGTTCTCGTTATCGGCGACAGAAATGAACGAGCGCTTGGACGTGCGAGACTCCTTCTCCGAGTGCTCAACCCCATCGGCAGGGgt
agcagcgtcagcgtAACTCAACATGTTGTTCTCGATGTCAGCAACAGGAGTCTTGTGCATACCGAGCACGATGCGCTCGGAGATGTAGAAGGCCGGATTC
AGGATAACGGAGAAGGCGATCGTAATGTGGAGCTGCATGAAGAGGTAAGCAAGGACGACCATACCCCAATCGGACGCGAAACCGAGCGTGGTCAAACCCG
TCTCCGCGTCCGGGTAGATCGACCACAGCAAGTTGCCCGAGATCTGGCAGCCGACAGCGGAGTACGCGGTACTTGCAAGGAccaggaagcagcaggagat
gagTGCGATAGTCACGCCCACCACGCGGGGCATACGCGTGGGGTCGCtgtgttggcgctggagtgcTGGAATCACGATACCAGCACCGTACGCGAGCGCC
AAGTTGCCAAAAGCACCGGCCACTTGCTTGAAGGTGAGGTCAGGCGACGGTACGCTCGGGTGGCCGCGCATGCCGTGCATcacgacagcgacaccgaTGA
TATCTGCGATAAGCGTTCCCATGCAACCGGCAaacgcagcaccagctccttccttGAGAGTTGGCACCAAGCACACAGGCAGACAAGTGACCGCCATGAG
GATGATCCATGTCGTCGCGCTGAAGGCTCCCGGGAAGAggccgtccagcagcgtgccTCCGAGCACCAGGAACACGCACGGCACTAGCAGGCAGTTGGCC
ATCTGCGAGACGACCGAGAGGTAGCGGCCGGTTTTGCCCATGCACCATTCACCGAGGTCACCGTAGGTCTTGACCGATCGAGGGGCGAGGAGCATGACGC
GGCAAATGGCCACCGAGGAGTACGTGTTGGCGAAGGCCATGAAGGCCATGGCGATGATTGCGATCACAGGGCCGGCGCGCGAGAAGTTACCGGGCATACC
AAGCGTTCCAATGCCgtagacgcagcagaagaggtTGAAGGCTGCCTTGGCGTCTTCCAGCGTGAAGACGGCCTTGCGTGCCATGGTGAAGTCGGTTGAG
GGGTCGCTTGAGGGGCCGGCGGAGAATTGGAGACTGAGCTGCAACGAGTTGGGCCTCTCAATCTCTTCTCCGGCCCCTGCTCAATAAGCTGAGCAACTAG
CGAAGTTCTCAGGCAAAGCTCAGCGGAGCCCAGTGAGCGTAGCAAACGAGGTTGAACGGGTTGCAGCAGGGACTTCCCGGGCGAGAGCGCGGCCGGAAGG
CGACGTCAGAAGGCGATGCGCCTATGAGAGCGCACAGATCCGCAGCACCGCACCTTCTAGGAGCACTGTTAAACGCTCACGCACCGGCACTCACGTCAAA
ACACCGGGTTTTGTTCAGTCAAATCA