Description :
From Genome Similarity Track
Location :
Scaffold_612:17- 6209
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_612-fgenesh-gene-0.1Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_612-snap-gene-0.4Phosphopantethiene--protein transferase domain containing protein
Pytiw_DAOMBR242034maker-piw_contig_612-snap-gene-0.73-hydroxy-3-methylglutaryl-coenzyme A reductase

Sequence
6192 bases(100 bases per row)
CGCTCCTGTCGCCGCGCTCACCCTCAAAGATTGTGTGGAAACGACTCTGGAAATACTCGACGTGGTGTCTCGCCTTGTGCTGCTCGATCTCCGCCAGCTT
GCGGTTGCTCTGTGCGGCCACGCGCTCGTACGAGAGCTTGGCTGCGTTCACGAGCGAGCCTCTGTCGTGGATCACGGCCTCGTTCTTCGCGACCGTCTCC
TGTTTTTTCTTGAGCCACTCGGCCGGGGACTCGAGGAGCTCTTTAACTACCAGCTGCTGCTGGTGATGTCGCTGCTTATCCGGAGACGAGGTCCACTTCA
ACGGAGACCTGGGTCGCGGAGCCTGGTGCAGCAGCCGCACCTGCCAGGATGCGGCCGAGCCATGCGCTCGCCTCCTCGGCAGCTCCTGGGGACCTCCACT
CACTGTCCGCTGAGCGTGGTCGCGCATCACACCCCGGGCGTCGCCCCCACTCTCGAGCACAAAGTGGTTGAGCGACAGGAAGACGCGCGAGCAGTTGAGC
AGCAGGCTCGTCTCAGCCTCGCTCTCACTTGGGGGCACATTGTTGGCTCGCGGCAGCACTGGCGACTGGAGTGTGAAGCGCCACTTGGCCAGTCGCAGGA
CGCTCTCGTTCGTCTCGAGCGTGAACTCGCGCGTGGCGCGATCGTCCCCGTAGTACGCAGCAGAGGGCACCGTGGCCTTGATCGTGATCAGCCGGAATGT
GTCGTGCTGAGGCTTCGACTGAGGCTGGGCTACTCCTGGAAGTGCATAGCTCAGCGCCGAGCCACGTAAGAGGTTCTCCTTGTTGGTCTGGTGTTTCGCC
GAATTGGACACGAATTGTCCACCTAAGTCCAGCTGGGCCTCGCCAGGGTCCTCGATCGAGCCGGCACAGCCCAAGTAGAAGTGCGTCTCGCTCAGTAGCT
GGCTCACGTCCACCTCGTCCACCTCGTCACTGCGATGGACGAGCAGCGCAGTGTCCACTCGGAGCCAGAAGTCGTCGTCCTCCGTGATCACACTCTGTCT
ACTCGGGTTGCGGAAGTCCGCAACGGTAAACATCATGTGCGGCCCTGCGGACAAGCTCGTGGCCGGACAGCTCCTGCCGTGCGGCCCCATGCTGAGCGGC
AGATCGCACGCCTGCGAGACGAAGCAGACCTGGTCGCCAAAGTGGATTGGCGCTTGCTTGCTCGTGTTGCTCTCGTCCAGGCCGAGCGTCCTATCATGTT
AGAAGAGCAAACAAGAGCAAGCTCTCAGTCTAGACACTCGCTCCAAGCCTGTCGATAAGCATAGAGCTACTCACGTGGGCTTGTGGCGCACGTCGCCGTC
CTTCTTGAAGTCGAGGAACGCAAAGTGCGCGTTCTTGACGCCTAAGAGCTCTCGAGCGTCTAGCGGCGGCGCCAATGAAGAGCTCGTCTTCTGGGCGCTC
TTTCGGAGCTTCAGTAGCGCGTTCTTGCCCTTGATCATCGCCAGCGTGTGCGCGAAGAGCGCCTTGGCCGACTCTGTCTCGGGCTTAGTTGGCGGCTGAG
AAGCCATCGCCTGGCTCTGGGCGAGCTGCGCCATCTTGCGCGTGGACCGAGTGATTGCCTTGCGCCGGTCGTGCTGATGCAGAGTCTCCACCTGCACGCT
CTTGCTGTGCATGTAATGGAGGAACGCCGCTGTGGGTCCGTCACTGTCGACCGTGAAGCCGTCATGACTGGTCGATAGCACAGGACTGGTGGTTGTCTCT
GTGTCGTTATGACTCGAGGCTGCGAGGACGCCTCGCTTGCGCAGGTTCTTGCGCAGAGCGCTCGCGTCGCTCTGTGTCTCAGAGCTGCCCTTTAAAGCCG
CGTCTGTGTGTCGTCGTGCCTCGTACACGAGCTTCATCGTCGGGACGAGGGTGCTGTCACTGGCATCACCACCTTTCTTCGCATTGTGCTTGCGATTCTT
CTTGTGCTGTAGCTGCTGAGGCGGTGGACTGTACTGCTGCTGGTGCTGCTGGTCTACAGTGAGTACAGCCACGAGACTCTGACCAGCGCGTACCTGCACG
ACACGCTCGCGGCTCTGCTCGATGAGCCCATGGATGAAGTGCTTCTGCGCGCCCGAGGCCATGGACCCTCGCTTCAGCTCAATCACAGCTTGAACAGCAG
CTCTTAGAGGACTCTAGCCAGCCATTGAGCGTTCGTTCTTATCGACACAATCCTAAAGATCTTTCTCTCCAAGAATAGATCTTTGCGTGTCAAAATCGAA
TGGCCACCGAAAAGATTTGACACGCATGAGACGATCCCAGATCTCCAGCAGGCGAATGGTTGCTCCTGCCTGTCGTAGCTCTTCGAATAAAGAGGCAATG
GGAACACCATGAAAAGCTCATTTGCACAGAAGACACTGGACATTGAACATTGTGATTGACGTGCACGAGGCTCTCTCTCTCAATTGATAAACAAAGGAAA
AAGGACTTCAGAAGATTTCAAAAGAATACATACACGTGCTTGCTTACTGGGCTGCGGTGGAAGAAAAAAACTGATGCTGGGCAGCGCCTTGGCCACACAT
CTTAGACGGATCCTTCCACGACGCCGGTGGCCTCGGTCTTCTCAGACTTCTCCTCGGCGTCCTCGGCGCTCTCTTCCTCCTCCTCCTCCGAGTCATCGTC
GCTCGACGACTCGTTCTCGTCGGCGTCTTCGTCCTGCTCGTCCGAAGCGGCCTGCTCCTCCTCCACGGCGGCCTCAATGTCCAGCACGGACTTGGGGGCC
TTGGTGGCCTTACGGCTCTTGGCGACGGCCACGCCGGCGATGCCGACCATGACGACGGCGGCGCCGATCGCGCCGGCGAGGAACGCCGGCTTGGCGTGGT
TCTCCTTGAGCCACTCGGTGGCCTGCTGCGCGTAGGTCTCCGTCTTGGGGGTCTCCACCGCGAGGGCGACGTTCTTGGCGTCCGGGGCAACTGCCGCCGC
GACAGGCTCCTTCTTCTGGACGACAGCCTCCTTGATAATGTCGAGCTCGACCTTGCCGTTCACGACGCGCAGGTGGAGCTTCTTGGCGCCCAGAGGCAGG
TCGATCGACTCGTCGAGCACCTGGTCGTCCTCGAGGTCCATGGACTGCTCGTAGTCCTCCGAGTCGTCAAAGTCGACCTCGACGTTGCCCTCTTCCATGT
CGCCGTCGATGTCGAGCTCGTCGCCCGAGTCGAGGCTGGCCGAGCTGTCGAGGTCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCCTTGATGTCCACGTCGTTGTCGCCCGAGCCGTCGAGCTCAATGTCGCCCGAGCCGTCGACGTC
AATGTCGGCGTCCTCGGAGATGTCCAGGCTCTCGTCGTCGTCGTCGCTCTCGTCGGCCGGCGGCGGCGGCGGTGGCGTCGCGGCCTTGGCGGCGTGGTGC
TTGTGGTGGTGCGTCACGCGGTGGTGCTTGTGGTGGTGGTGCACGACCTGCTGGTCGGCCGCCTGCTCGGCGCTGGCAAGCGCCAGGGTCGTCGCGAGCA
CCGCGAGGGCGAGGGTCTTGCGCACGTGAACCATCTTGAGTTGCTTCTTGAGACTGCGAGTGAGAGAGAAAGTGAGGGCAAATGGAAATGAGCTCTTGGA
ACTGGTTTCTTTTTCTATTGGATGTTTGAGAGCGACTTTGAGAGGGTTTTGCACCCATACCCTCTCAAAGCCGATAAATCAGTGCGGATTGGAGTTGTAC
CTCTCATATTTTATAAATTGGGTTTATCTGTTAAAAAGCAAACAGAAGAGAATCCCTGTCCATTATAGAAATTGCTACTTTGTTTTCATATTCCTTCAAA
TTTTTAAAACCAAAGATTTAAAAATTTATACTCCTTGGGAAACGATTTCAGATGGCATGTCAGCGAAGTGATCCAATTAGAGAGGGAACTTCTTTTCAAA
GGGTACAAACCCTGTCGAATTCGATAAATCAGGGTGTGGGTGATTTTTTCTGTCATTTTCTGTGGTTTGTTGTGGAAACTCAGATGTTTTTTTCACAGAT
TTTCACCTCGTATCATGCGTAGCGGTAAATATAGAGTATTACATAGGATATAAAAAATATTATACGTAATGCTCTCTTTGCAGAATTTATTGCATACTAT
TATTCACTATAAAAGAGATTTTAAAGAATTGCATATTACGAACCCAGGCGTTGTTCATGAGAGAGCCTTGGCAGCTGACACTGGTGCTGTGCTTTCCAAC
TCATAGATCGCACACAAAGGTGATGAATATGTGGCTCTCATATAAATCAACCACATAGATACATAGCCCAACCATATTGACGTACAAATCAAGCACATGA
GTCAAAGTATAAATGCCCTATCAGATCTCACAAAGCGTGATTTATAACTCGGGAAAAGCGTGAATCACACGACATCCGATCAAGGATTGCGAAAGATTGC
CTGAAACCCATACATTTTCCAAGAGAGCGCGCGTCGCAGGAAATCCACCCATGCAAGAAAATCCAACATTGCATGTGTGGTCCACCTCACACATCAATAT
TACAGTAACCACTCTTCAAAGTACGATTCAGCAATATGAGCTGATGATGCACATCAAAGAGCTCTTTTGGAAAATGGTCAAGGTGTTTGGCGTGGGCGTG
GACATCGCGCATCTCCCGCGCTTCCACGCGTGCTTCGCGCGCCACGGCGAGCGGTTCCTGCGGCGCGCGTTCCACCCGAGCGAGATCGCAGAGTTCTACA
GCAAGCCCGCGGCCGCTCGGCCGGGGTTCCTCGCGTCCAGGTGCGTTTACAATAGCGTAATGCCAATGACAAGTTGATGGCTGAACGTCGTGTATGTATT
CTATCAGATGGGCGGTGAAGGAGGCGACGTACAAGGCCTTCCAGCGGTATCGCGTGCTCTTTCCAGAGATCCGCCTCGTAAAGCAGTCGTCACGCGACGA
CACCGCATCAGATGGCGATGCTGCGGACAAGTTCACGCCTGTGCAGACCAAGCTGTCGATAGCAGAGACGTCGCAAGCGCTGCGCTTGGAGTTCTACGGA
GAGACGCTGGCGCTTGCAGAGCAGCTCCGCCTCGTGGTACGCGACACGTCTGCATCTCTTCATGGATTTGTGGAGCTCTTGCTAAGACAAGCTCTCGTGT
ACGCTTTACCCAGGAGCCGCACGTGTCGATCTCCCACGACAACGACTACGCCATTGCGTACGTGGTGCTTCAACAGAAGCCATGAACAGAGCTGGCGGGA
CGGTTGCTTGCTGGTCAGCACCGCATAATTTAAGTGACGCTCATCCAGAGAGGCTGGAGTCAACATCGTGCTGGTGTGGGCTATTTATTTATTTTCTGTA
TATCGCTTGATTCACTCAGTGTCAAGGCTCTCATCGTCCAGTCCACCTCAGGATCTAAAAGGATTCCTTGCGAGATCGTCTGCCGCTGCGCTCGCCGTAG
ATCTCTCGGATCAGACGCGTGACGCGCTCGACCGCCGAGAGCGAGAAGACGCGCGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTGTCGCGGTCCTGCGTGATCGCCTTCCACTTGCCCTGCGAGTACAGGTCCGTGACACGATG
GAACTCGTCGACGTGGTCCTCCGCGTCCACGACGTTCACTCCCCGCTCCCGCAGCCAGAACACAAACGCGTTGGGCTCGCGCTCGGTCACGGCGCGCGTG
TATCGCGCCAGGTCGTGGGCGATCGTGCCTTCCCACTCCATGTGCTCTCCGATGCGGCTCAAAAAGTCGAGGCGCTCGGGTGTCACCGCGTCACTGGCGA
GCGTCAACGAGTCGATGAACAGCAGCATCGTCGCCTGCCAGCGCTTGGCCTGGACTGCCATATGCGCGAGGAACTCGTCGCTGAGCTCGCTCTGTGTGAC
CGCAAGCACGTCTTTCGCCTGCGGGCTGAGCTCGTAGCTCTTGACGATCGAGCTGAGTAATCGCCACTCCTCCGTCACGAGACGCTCCCGAA