Description :
From Genome Similarity Track
Location :
Scaffold_1285:17- 5090
Transcript NameFunction/comments
Pytve_DAOMBR484snap-pve_contig_1285-abinit-gene-0.0Gag-Pol polyprotein

Sequence
5073 bases(100 bases per row)
CAAGACGCAACAGGTTATGAGCCCAACGGGCGCTCACTGCTGGTTCGTCTAAGCGCTCATGAGTGATTCGAGTGCTGAGAGGAAGTTGGAGCGAAAGTCC
TCGGTCGAGCCACGATTCGACGGCAAAGACTTTGAGGCATGGATGGAACGAATCAAGCTGATATTGCAGCTCAAGGGCTTATGGGAGCACTGCGAGACTG
AACAACCTGTGCCTGACGAAATGGAGGATGAGACAGCATATCGAGCGTACGAAAGGGACTCGCGGCGCACACTGACGTGTCTGTACAACGGCATGACGAA
TCAGATCCTGAAGACGGTGATGCATGAGGCAACGCCTTTCAAAGTGATGGAACGGCTACGCCAGAGATTCTATGGCAAGACCTACTTTGCATACACCAAC
GCTGTGGGCGATCTTCTGCAATTGAAGCTGGCAGACAACGTCAACGTTACTGAACACCTGAGTGAAATGCGCCGACAGTTCAAGAGGATTTCTGTACTGG
GCGATCCGATCCCAAACTCGCTCAAACCTGCGCTCCTGATTAAATCACTTACAACGGAGTACGACAACGTCGTGGAGATGTTTCTGGCCAGCCACGTACC
AACGACAGCAGACCCTCCAAACTATGAACAACTGGAACATATGCTGGAGACTGCATACGACCGTCGCCATGCTGGATCTGCAGCATCCAGTGGAGCTGAT
GAAAAGGCCCTGCTGGCACGTACATCGGCCGGTCGTGGTCGCGGACGTGGACGTGGGCGAGGACGAGGTCGCGGACGTGGACGTGGACGTGGTCAACGAG
GAAGAGAGCACGACAATCCTGGACGTGGTGGACGAGAACCGCGGTGTTTCTTCTGTGACGAGACGGGACACAAAATCAGAGATTGCCCGCAACTCAAGCA
AATAAATGACAGTCACGATGACGATCGACCGACAAAACGCAGTCGCTTCTCACCAGACAGCTCAACACGATCAAGGTCGCGAAGCAATAGCAGTTCGCGA
GTTGAGCGACATTCACGCGGTCATGAGAGTGATGATAGTGCCTACGTGATGATCTGCAGTGACAATGAGAAAGATCTGGCCCCACCTTTAACACATGAAC
ATTGGTACTTGGATTCGGGCGCCTCAAGTCATTTTACCAACTGCAAGGACGACTTCGTGAGCTTCACGCCATTGAGTGCTTTGGTGGAAGTCGGTGGTAG
GACGAAGTTACACGTTGAAGGCATTGGTGATGTGACCAAGGAAATCAAGACCAACAAGGGCATACGTACTATCGTGATGAGAGATGTGCGGTATGTCCCA
GCACTTCAGTGCAGTCTATTTTCTGTGAGAGCACAAGTTAGTCGAAGCCTACCCCCTCTTGAGAGAGTAGTTGTGCAGTTCGATGATGAAGACAGCGCAC
GCATGAAGGTTGGCGGTGCTGATGCGCGAGCGAGGGTGGATGATGCAAGACTGTACCGAGTGGAGTTCACAAGTGTGAGGGATTCAGTGTTGTTGGCAAC
CACAGCCGAGAGTGCTACAGACCTTTGGCATGCACGACTTGGACATCCCGGCAGAAATGCATTCAATGCGCTATGTCAACACTCGGAGTGGCCATTGCAA
CATCTAAATTTGCGGATACCTGAAGGCTATCAGTGTGAAGCCTGTGTCAAAGGCAAAATGACACGACGCGTATTTCGCAATACGAAGAGCGTGACTCGCA
GGTGGCTTGTTGGCGAGCAAGTACACCTCGATGTGTGGGGACCGTACACGGTGAAGACTTTCGGCGACAAGCGGTACTTTGCGGTACTAGTTGACGACGC
AAGTCGATTCTTGACAACCTGCCTATTGACTCACCGGACGGAGATTTACGCTTGCTTTGAGAGATACTATCAACGAGTGAAGACGCAACTTCACGTGCGC
ATGAAGGCTCTACGGTGTGACAATGCCCGAGAATTTATGGCACTCAAGGATATCTGTGAACGCAAGTACGGCATGGAGTTCACGATGAGTATTAAGCACA
CTCCAGAACAGAATGGGGTTGCCGAAAGAATGATCCGTACTGTGACTGAACGCATGAGATGTCTTCTGAGCTACTATAGTCTGCCCGAGCAGCTATGGGG
TGAAGCTGTCGTTACAGCCACGTACTATATCAATATCGTGCCCAACTCAACGAGAAGAATGCAAGTGCCGTACGTGCTCTGGTACCGAGAACTACCGGAG
TACATGAAGTTGCGCAAGTTTGGCTGTGCTGTCCTGGCATATGTAGACAAGGTTGAGCGTCAGAAACTACAGCCCAAGGCCCGTGAAGCACTATTCGTTG
GCTACTCACGTGAGCAACGAGGTTATCGGCTCCTGGACAGCGCAACACGCAAGGTGTTTTACAGCCATACTGCAGCGTTCTACGAGAATAAGGCCGGACG
ACTGTTGCCTGCAAGTACCGAGCCACGAGTGGCGTCTGAGTTGACAACGACACAGTATCTGCAGGTAAGTCCAAGTGAGTTGGACCATGTCCCTAACCTA
ATGAGAGAAATGCATGCAATGAACACTGCTCGAGGGATCGTCAATGAGAGGACGGGATTGGGCCTACGGGAGTCCAGTGAGTGCTCGTCTGGTGGGGCAG
TCCAAGCCAATGAGACGAGCTCCTCCCTTGCTTCACGTGCCGATGCTGTGGCCACGAACGTGCATGCTAATCAGGGAGAGCCGGCACTGAGCGTACTTGG
CTCGAAGCGAGTACGTTTTCAGCTGGACACCACTCGCCATGAGCATCACGAAGTGGGTACAGACCACATGAGGGACCGTGGAACGAGACCACGTAAAACC
ATCGTGGAACGAGATCACGTTAAACGTTTCATGGTACGAGACCGCGATATGCTCTGCGGAACGAGACCGCATGAGAAAACCGTGGAACAAGACCTCGTTA
AACATTGTGGAGTGAGACCACATGAAAAAACCGTGATTGAAGACCACGTAAAACGGCAGTGTTCATCGAAACTGCAATGGAAGGAGTCACAGGTAATGGC
GGGTGTACCAACAGCCAATGTGCGGGCTCCTACTCTGGTCAGAAGGACCTGTGAGATAACGACCACAGCCCCAGAGTTGGATGAGCCGACGGTGTGCACG
GCACCGGGGTGCTTAACAGCCTCTGGTGTTCATGATACACATTGCGACAATACTCCTAGAGGAGTTGGAAGCAAAGTTGTCTGCCCAGTAACACGGTGTG
GACGCGCGACCAAACCGCCCTACTGGCTGAAGGACCACATCCACCTGACATACCTGTACTCAACTCCAGACTCAACGCACAGAGATACTAACTGGACCAT
GGAAGAGGCGGCAATGCATCGCGAAATGGCCACAGTGCAAGCTCAGGCGTGGTGGAATGACTACTGCTGCCTGATGAAGTGTGTGAATTCTTTCCCAGAG
TCTTTGGGGGCTGCCATGGTGTCAGAGGATGCCGACAAGTGGGAGGATGCAGCAAATGAGGAATATGATGCTCTGAAGAGAAACCTGACATGGGAGTTGG
TGCCACGAGAGAGACACATGAAAGTTCTGCCCAACAAGTGGATCTTTCGCATCAAGTACCTTGCAAATGGTGACATTGAGCGGTACAAAGCCCGCCTTGT
GATCAAAGGATACATGCAAGAGTATGGCGTTGACTACCTCGAGATCTACTCCCCTGTTGTGCGACTTGAAACGCTGCGAATTCTACTGACACTGGCGGCT
GTTTGGGACTACGAGGTACATCAAATGGACGTGACTACAGCCTTTCTGAACGGTGATATTGATGTGCAGGTCTACATGGATCAACCTGAAGGATATGTGA
TTCCAGGTAAGGAGACATACGTGTGCCGACTTCGCAAGAGCTTGTATGGTTTGAAGCAGGCACCACGCGTATGGTACAAGCTCCTGAAAGCGCATCTCGA
ACAGCAAGGTTTCACACTACTCGGCTCAGAGACGTGCGTCGCAGTAAAAGTGGTGGCCGGGTATCTCTGCTTTATCCCTATCTACGTGGATGATTTGATT
CTCTTCACACCCACCATGACGCTGATGCGAATGCTCAAGCGGATGCTAACTCAGCGTTTTACCATGAAAGACGGCGGTGAAATCCACTATATTCTCGGTT
GGGAAATCCGGCGGAACAGACGCGAGCGCACGATTTTTATTGGACAGAGCAAGTACATCGACTCCGTGCTGGACAAGTTCGAGATGAGTAACTGCAACGG
GAGCAAAATCCCAAGCACAACTGACATGAAGCTGACGCGTGCAATGTGCCCGGTCGACGCGGACGAAAAGGCTCTCATGCAGACAAAGCCATACCGATCG
ATCATCGGCAGTCTCATGTATTTAATGCTGGGGACAAGACCGGATCTCGCCTACCTCGTTCGTGAATGCAGCCAATTCTTGGAGAATCCTGGACTACTAC
ATTGGCGTGCAGCGAAGCGTGGACTACGGTATCTCAAGGAAACAAGAGATTGGGGGCTACGTCTGGGTGGAATCAAGTGGGCAACAGCTGACCTGGACAA
GAACCTGGAAGCCTACGCCGATGCAGATTTCGCGAATCGCATCGACGACCGTAAGTCTGTCGCTGGATATCTAACGCAGTTTTGTGGCAGTACTATTTCC
TGGAGCAGTCAGACCGAGCGTACCGTTGCACTACACACAACCGAAGCAGAGTATATGGCTCTGAGTATGCTCGTACAAGAGGTCATTCATCTACGACAAA
TGCTGAAGGAGTTGAAGGTGCAGCAGCACAGCCCATCGGTCGTGTACGTCGACAACGAAAGCGCGAAGAAACTGGCCAAGAATCCAGAATACCATGGACG
GACAAAGCACATTGACGTCAGGCACCACTTCGTGCGAGAACGCATTGAGAGGAAGGAAATCGACGTCGTTCATGTGGCTGGAACTGACAATGTGGCGGAT
GCGTTCACGAAACCATTGTGCCAGGCCAAGTTCACCAAGCATCGTGCAACAATGGGACTGATGGCAAAGAGTACGTTTCTACGTGACAACGACAAACCAT
AGCAGAACAAGATCGACAACGAAACGAGGGTGTCACCATTAGGTGGGGCTGTTGCGGAGTAATGGCGTCCACC