Description :
From Genome Similarity Track
Location :
Scaffold_1345:17- 4806
Sequence
4789 bases(100 bases per row)
TCTTCATCCACCCAGGATCCTCGGGGATCGGAGAATCAGAATCCGAGCGTTTGGGCCTTTTCTTAGGGGGCGATCCCTAGTCAGCGCCTTCATCCCATAT
TAGCTCGAGGGAGTGATGCCTCGCGGCCCAAGACTCCCAGGGATCTCGTCTTTCCCCTTTAGGAACAACTTCACAATCTCCAGCGTCCAAGGGCGAGAAG
TAAAGCTGCCCACTGTCCCAAACGTCCTTTGTAACCCGGCCGACTTGAACAGCCAAGCTAGACGTAGAGTGTCGAAGTAAGGATCCGGATGGATCTTCCC
ACCAGCAGGTTGTAATTGAGATCCAACACGCGCAGGAGCGCGAGTATCACCTTCTCCACCGCTCCGTAGTTCAGTTCGTTTGGCTTTAGCGTCCGGCTGA
CGAAGGTGACTGGATGACAGATCCCTTCATGTTCTTGTACCAAGGCTGCTGAGACCGCCCAGTCCCTGGAATAAACTATCACCGTAGGTTGACGTTCCGG
ATCGAAATGACGGAGGATGGGTGTGGTCGCGATCCTGTTCCTCAGCTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGGCTCTACCCTTTCCGAGTTC
TGATCCGTGGTTTTTATCCCGATTGGATCCTCTTTCCTTTGGTCCCGGGGTGGATCCAGCTCCTGTTTTAGGTCCTCTTCTGGCGTCGTACTACTTGGAT
CCCTTCGTGGATCTGACATCTCCAGGGCCAGAGCTTGTTGGATTTTGATCCGGACAGCTGGAGTGGTCATCGCAGCAAAATCTACCTCTCTCAATTCATA
TAGTACCGCAGCAAACAGTGCGTAATCCTCGATGAACCGACTGTAGTAATTCAGACTGCCCAAGAAGGATTGCATCGCCCGTAACGACTGTGGGAAGGAC
AAGTCGGCTAACGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAGACTCGATGGGCTAAGTCATCCACCTTGCGCATCCCCCAATAGCTCT
TCACCACACTGATAGAGAGATTCCACTTAGTACACGCCTCCAGTAGGGATGTCACCCTTTCGCACAACTGATCCCACGATTCCGCCGGGATTAGAATGTC
GTCGATATAAGATCTGCGTCCTAACACAGACGGGGTCCCAGGATCCCCTGGCTCCCCCGCTTCGAATGGATCCACTTCCGTGTGATCTTCCCCGGATCCA
CCCTTTTCGGGTTCCGGTATTCGGGTGAATCCATAGAGGGCGTTATCGATGAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGT
TCCACTCGAACAGGCCAAACGGTGTGATGAAAGCGGATATTGCGCGAGCTCGATCCGTCATAGTAACCACCCAGAAACCACTGGCCATGTCTTGAGAACA
GTACCAGAGTACTTTATCCAAATCTTCCAACAGCTCATTAATTAGAGGCATCGGATACACCATCAATCGAGTCAGGCCGTTAACTAACCGGTAATCAATG
CACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACTGGAGATGCCCACGGGGATGACGAGAAACTGATGATCTTGGCTTGCAGCATGCCCT
TAATCAGATCTGATAGGTTTTCTCGGAACTGAGGCGCCACCTTCCGCACCCTTTGTGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCC
GCGGGCGGGGGGCGGTAATGCATTACCTATACCAATCAGCAGATGTCGGCTTTCCCAGATATTCTAACATATCCGTTCCACTTCCGCGGGCTCGTTTGCC
CCTGGATTCACTTGGGATATCGTCAATCGTGTCCTCCTCTGTGGGCAGTGGCACCTCCGGGATTAGCGCCAGGCCATCCCCGAGATCCTCGGCGTGTAGA
TCCCCGCCTTCATGGTAACAGACTAGTTCATCTTCCGTCTTCGTCGGATCCACCATTGGATCCAAACACCGCGACCCTCTTTCACCTGGCAGTCCTTCTG
TCTTCGTGGGATCTGGTACCCTGGTATCGGGGAAGCCACCAGTTGGATCTAGTCGATCCTCTAGCGAGTTTAAACCCGACGGCGCTGGTTTGACTAGTGT
TGCCACTCTCGATAAGGATCCAGGCACTTTGCCCCATGAAAAGTTAGGATCCACTCTGGGGTCAGCGGGATGTGGCGGTCCGGCTTCAGCCTTCTGCGAT
CCTTCATCCACCGACCCTGTGTTATCTAAAGGCCGACTCTGGGGATCATCCCCGGTCTTGGATCCAACCTCCATCGCTTGGACCTCAATCCGACGATCCC
TCTGCAGTATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCACCTCTCCGAGGGATTCGATCTCGGT
AGTCGCCTCGTACACCAGATTCTGCCATTTTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCCAACCATCGT
CCGATCTCTTCATAATGGTCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGCGATCGACCTGGTCCCTGGATTACGGTAGGCACCC
ATTTTTCGCCTCGAGTGACCCACAGTTTCTCATGTTCCACCCACTTTAGCCGATCTGGCAGTTCCCAGGTTTCTCCGGGCTCGATCCAGGTCGTATTATC
TGCCCTTATGATCCTCATCTTCGCTCCATACAACGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCTGCCAGATCC
AACCTCACTCCGGCTGGTACCATGAAATCCATCCCGAGGATGGCATCTTGACCAGCGAGATCTCCAACCCAAATATTGAATTAGTACACCAAACAACCTG
CCAGCGTGATCTTGATCCGCGTTCTGCCATTCGTACGGTACACGCCTTCACCAATCCCCAACACAATCTCGGATCCGACTCCCATCCACTTGGCACCCAA
CCCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATAGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTT
GTCTGAACCACTTTCCCGGGGCATGGTACTTCCAGTACCCACGGGGCTCTCCTGTTAGCAGATCCATGGATCCAATATCCTCAGATCCATAGGATCCAGT
GACCAGACAGACCTTAGGTGGATCTGCAGTGACTTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAGTAACCACGTGCCTCTCCT
CTGTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGCAAACTCATCCACTTGGCGCAAACTAGAGATCTTGGCAACTGACACTTCATGTAGATCACGTG
TATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAGTACCTAGAGCGCTCGGCTCGTACCGGATT
CAAACCCGGCGAGCGTCCTAGTCTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGA
ATTCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCTCCGGGATGACCTTTCTTGCCACACTTCTC
ACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGCGAACACCTGACTTGGGCTGTCCCGTCCATGAGATCTCGAGATCTG
TACATCCCACGGTCTCCGGGTACGGTATCCCTCGGTCGAGAGTTGTCTCCGGTCTTCGCCGTTCGATCGTTGGACGCAGTGAGACAGACTTGACGGTAAT
CTTCAGGGTCGGAGTCCGAAGCGTCGGATCCTGACTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTGGGCGTCGGAGC
CTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTTGCGCGATCCACAGCCCGCAGCACTTCTTCGAGCTCATCTGCGTCTGGA
AGACGTAACAGGGTCAGCCTGTCGGCCAGATCCACATCTCCCAACGTCTCGATGAAGTGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTTGA
TCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCCAGCGGGGATTCATCCGATCTGCGGCGAGCGTGGTAGTATTGTCGTGCCAC
CGACACTCCCAATCCACAGTACTGGGTCTGGAAGCTGCGCAGCAAATTTGGCCACTTGTTCCTGGTGGATCTACCCAGCCGCCGATACCAATTCCTGGCT
GGCCCCGCTAGCAGATCCGCAAAGGTCAGACACTTCTCGGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTAACCTTGCTGATCCATGTTCTCGCTC
GATCCTCGTCTTGATCCTTGCCCGTGAACTCCTTCAGATCTGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCCGCCCCGGCTTCGGC
TGTTGCTACCACCGCTGACGAAGGGGATGGTCCATCCAGATCATCTGGGTCGAACTCATCATGGGAGTGGTCTCCCTCCACTGACTATATCTCCACGTCT
CGTGCTCCATGTTCGTGGAGCACTGGCGCTTGTGGCACGGGCGCTCTCATACCCTGTTCGGCCAGAAACCGACTCATCGCAGCTTCGAA