Description :
From Genome Similarity Track
Location :
Scaffold_1300:17- 2714
Sequence
2697 bases(100 bases per row)
ATCAACTATCGCCTCCACTTCATACTCGCCTTCTTCTTCGTCCGGCTCAAACGAGTCGCCTGGCAGCAGCTCCTCGTCAAAGTCCAGCCGCTCTCCTTCT
GCCACCTCGAGCTCCGCAGCCGGGTGGTCGACATACTCCCGCCAGAGCTTCAGCCAAGAGACATGCACCTTCGGAAAGAGTCGATATCTGGTGCCTTCTA
TTTCGAGACGGACGACGTGATCAGCTAGCCGCTCCAACACGCAGAAGTGGCCATGCCAGAGGTGCGCCAGCTTCTTAGCGTAGCCGGGCTTGACCTGATT
CACATAGACCCAAACGTGTGCGCCTGGGACGATCGTGTCAGAGTCGCCTCGCTGATCTTCATTGGCTCGGTCCCtCCGTTTTTCCATGGCTTCTCGCAGC
AGCCGGCCGACTTCTTCTCTCGCCCGCTGGTACTGCGCCTGCACGTTGGCTCTCCATTGGCGGGCTTCGCGGTGTCGCCCCTGTCCTTCGGCTGTGGGCA
AGGCGACTTCAATTGTCGTCTTCGGCTCCCACCCATGTAGGAGGTAGAACGGCGTATCACCCCGTACGCGATCGTAGGCGGTGTTTACGGCCAGCACCAG
CCGCTTGGCGTAGTCGTCCCAGTCTTGCTGGTTCGGGTCGGCTACGTACAGCTTGACTGCCCGCGAGATCGTCTGTACCATCCTTTCAGTCATACCATTG
GACTGCGGCCGATATGCCAGAGTCGCCTTGCTCCGTGAGCCTGAACACTTCTGACATGAAGGCCGGCTCGCGGTCGTGTCGTATGATGTCGCTGGCTCCA
AACCGCCTGTAGACGGCTCGCTCGTACGGTTCGGCTACCTCCTGCGCGTCTCGGCTCTTGTTTGCACTCACGATGACGAATCCAGAATGCTGGTCTACCC
AGAGCAGAAGCTCCGTGTTACTTCGATGCGACTTTGGCACCGAGGGGGTGTGGTCCATCCCCAGCACCTGGAAGGGCCGCGTAGCCACTACGTTGCCTGG
ACTCGAGGTGACCAATCTAGGTGCACCTTTCCCTGACTGGCAGTCCGTGCAGCCGAGCACGTAATCGCGGACGTCTTGATACTGGCCCCGCCAGTATAGC
AGCCTCCTCGTCCTGTCGTACGTCCGGCTGACGCCTTGATGCCCACCGTTTATACTCGTATGGTAATGGTGTAGCACCTCTCGCACCAACGTCGAAGGCA
ANNNNNNNNNNNNNNNNNNNNgCTGTTGCTctCCGGCGTCTTTGCTGCCACCGTCGCGCGCCTCCGGGCGTGTCGTCGTGTTACCGTGTTCGGCTTCGGT
GCCATCATCTGCTCTGTTCACTTCGTTCGTGCCACGTGGCACCCGCTGATCATCCCCTTCGACGTCGCTTGCAGCCGTGTCGTTCAGCCCGACGCCTTCA
GCTACACGCTCTCCACAGGCGCCTTGCGCTGCGGCGTCCTTGCGTTGCTCCGTGACCTCTTCATGCTCGCTGTCGCGTTCGTCTGGTGTGTTGAGGTGGA
CACGCTTTTCCGCGCCCCTGGCGTCCGTCGTGCTGTGGTCTGTGACTGACTCGCTCCCTGTCCCACTTCTGTTTACTCCAGTGTTTACTCCCGCATGGCG
TGCGGCGTCATCACCTGATGTGTGGTCGAATGTACCCATATCAGGCACGGGAGTGATGGTAGTAGGTGGCGGAATGGCTGTATCGGGACGCTCGCCGTCC
GTCATGCGCCCACTtCTCGTCACAACCTGTATCGACGCCGGCCGGTTGTCAGCCGTCTCCGCACTCGCAGCCAGCGCTAGTGGGAGGCGGTTGAGCAGCT
CCATGTCCGGATACTCGCCTCGGCCGACTTCTCCTCCGGCTTGACACTGAAGGGCCTTGCCCGTGATCAGATCGGCTGACGCGTTGTAGTCTCTAGTCAC
CTGAACCAGGTGAGCGCCCCTGAACCGGCTCAGTTTTAGCAGCGCCcTCTCACGCAGCACCTGAAGGCCAGGTGTACGACACTCGATGTCGCCTCTGAGT
TGCTGGATAACGATGCGAGAGTCGCCACACATGCTCAGGCGCTCTATGCCGTGCCGGGAGGCGAGTTCCAAAGCGGCGATGGTGCCCCTGTACTCTGCTT
CATTCACGGTACTAtCTTCGAAGAACTGTGTCCCAGCCGCCACCACGCTCCACTCAGGTGCCTTCCAGAGGATAGCTCCACAGCTGCCGCCGCCCCTCTT
CGGCTTAGCCGATCCATCAAAAGAGACGACCCAGGCCTCTTCATCGGCTGCGAGCTGGGGGATTGGCAGCTGGTGCCTCGTctGGGTGGTTGCCTTGTGC
GGTCGAATCGCCTCCAACATCGCGTCTGTATGATCGGCTGGGCCGATTGtGGCCGCCAGCAGCCCAGTAAGGCCGTCTTCTCCTTTCACCGCTCGCTTGA
TATCCATCGTCCACGGCGATAGCATGACCGCCCAGCGTTCTAGCCGCCCcTGCAGCCCCTTaGACTTGAAGAGCCACGCGAGAGTgCTGTGTCGAGTGAT
CACCTTCAGCTTCCTCCCTGCCAGCAGATTCGACGCACCCGCGAGCGCCTGAAGTAGAGCCAACACCTCTTTTTCTGCGATAGCGAATTTCATCTCGTGC
GGCTTCAACACTCGGCTGAAGAACCGAACAGGTGCGAGGGTAGCATcGTCCGGCTGGGCCAGCGTGCAGGCGATTGACcAGTCGTTCGCATACAGTA