Description :
From Genome Similarity Track
Location :
Scaffold_2272:17- 2270
Sequence
2253 bases(100 bases per row)
CGTTCAAGTAGAACGGCGTGAACCCCGTGGACGCGTGCACCGCGTTGTTGAGCGCAAACTCAACAACTGGAAGCTGCGTCGACCACGTACGTGGTGCTGC
CGCGCACACACTGCGCAGAGTGTCCTCGAGCACTCGATTGACGCGCTCTGTTTGGCCGTCGGTCTGCGGATGGTCCGCAGTGGACATCTGCAGACGAGTT
CCCAGTAAAGGGAACAGCGTTTTCCAAAACGCGGCAGTGAACCGCGGGTCTCGGTCCGAGACAATCGTCTCCGGGAGACCGTTATGGCGGAACACGCCAT
CGACGAACAACCTTGCGGTTTGTTCGCCCGTTACAGTGACGGGAACTGGAGCAAGATGTACCATCTTGCTCAGCCGACACACGAACACCAAAATTCCGGT
GTTGCCGTGTCCGTCGGCGGGAAGCCCAAAGATGAAGTCAAGACTCATCGACTTCCAACAATCAGCCGGTACGGGCAGGCTCTGTAGTGGAGCCGAAGAG
TGCCCTGCGGGTTTGACCCGCTGACATGTTTCACATGTCTTGATGTACCGGGCGACCCACTTGTACATGTGGGTCCACCAGAAGGACTGAGAGACCGACA
GAAAGGTCTTCTCGCGGCCCAAGTGGCCGCTGGAGGGCGCGTCATGCGCCTCCGCGAGGATGTCGAACTTCAGATCCTCGTCATTGGGTACGACCACCCG
TGGAGGATCAGTGGGCTCCACCCGATAATAGAGGAGGCCCTCCTTCAACTCATATCGGTGGAGCCGTGAGCGCTGTCGCGACGAGAGCCAGTCGGACTTC
GCGCTCGTTCCGGCCTTAAGGAACTTGACGATAGGCGCGACAGCCTCATCGTCCCGATACGCCATGCGTATCCGATCATATAGATCCGTTGTCACCCGCG
TGATGTGGGCCAACTCATAGTCGGGACGCCGAGCGAGGGCGTCCGCAAGCACGTTGAGCTTGCCCGGCTTGTATTCGACGCGGAAGTTGTATTCCGCGAA
GAAGGACAGCCACCTCGCCATCCTTTGGATGAGGTGAGGCGAGTTAGTCGCCGTCCTCAAGGACGCGTGGTCTGTGTAGATCACAAAGGGCCTAGAGCCC
AGAAGGTGAACACGGAACTTCACAAGGGCATATTTCATTGCCAGGAGCTCCTTGTCATGGACAGGGTAGTTCCGCTCGGCGGCTTTGAGCTGCCTGGACT
GGAATGAGATGACTCGTTCCTGTCCAGCCGTGTCGTCCTGCAGCAATGCACACCCGATGACGTAATCGGAGGCGTCGCAGACGACGCTAAACGGCTTCGT
CTCGTCCGGCAGAGCCAGGACAGGGGCCTCTTGGAGACTGGCCTTGATGCTGTCAAAAGCATCCTGGTGCTCTTGCTCCCAGCGCCAGTCGACGTCCTTC
TGAAGGAGGCTCGACAAGGGCTTAGCGAAGCCCGCGTACCCAGCGCTGTACTTGTGAAGGTAGTTGGCCAAACCCAACCACTTTCGAAGATCCTTCTGGG
ATCGGGGCGTCGGCCATGCTGCTATGGCCTTGACCTTGTCTGGGTCAGCCCGAACGCCCACGTTGCTTACGAAGCAACCGAGAGCTTTGATCTCTGGTGA
CGCGAAAACGCACTTGTCGATGTTGGCGTAGATCTTGTTCGCTCGCATCACGTCCAACACTCGACGGAGGTGTCCTAGATGCACCTCCATGGCCGTCTTG
CCTCCCTCGGCACGGCTATGGACGAAAATGTCGTCGAAGTACGTCTGTACGAAGGTACGCAAAGGGCGGAACAATTGCGTCACCAGGCGATTGAACGTCG
CCGGGGCGTTAGACAAGCCCTGCGGCATGACGAGCCACTCCCAAAGCATGCCGCTTGGAGTGCTTACCGCGGTGAGCGGGATGTCACTCTCTCGCATCAG
GATTTGGTAGTATCCGTCTACCAAATCCAGCGCACTGTACAGTACGCTCCCGGCCATGTTGTTCAACAACACATCCTTTCGTGGGATCGGTGTTTGGGCC
GGCACCGTTGCGTTGTTCAGCTTGTTATAAGCGTGAACCAGACGCCACTTTCCGTTCGGCTTACGAATGCAGAAAGTCGGCGTCGAGTGCGGGGAGTTCG
ACTCCCGCACCATGCCTGCCTTCGCTTTCGCGGCGAAGAAGGCATCAATGACCTCGCACTGTTCGCGCGGGAGAGGCCATTGCCTCGTGACACAATACTT
TGTGCCGGGCACGAGATCAATCTCGTGCCGTACGCCTCGATCCGGTGGGAGTT