Description :
From Genome Similarity Track
Location :
Scaffold_3957:17- 1706
Sequence
1689 bases(100 bases per row)
CCCAGAGTACCTTATTCCACATCTTCCAACAGCTCATTGATTAGAAGCCATCGGGATACACCATCAATCGAGTCAGGCCGTTAACCAGCCCGGTAATCAA
CGCACAGACGTATATCCAGCCCGTTCTCTTTGGATGATGATTACCACCGGGGGATGCCCACGTGGACGTTGAGAAACTGTATGATCTTGGCTTGCAGCAG
GCCCTTAATCAGATCCGATAGTTTTTCTCGGAGCTGAGGTGCCACCTTCCGCAGCCTTTGAGCGATCGATTTCGCGTTGCCGACATCGATGTCACATTTG
ACTCCACGTGCAGCAGGCGGTAATGCATTACCTTTACCAATCAGCAGATGTCGGCTTCCCGGATCTTCTGACGTAACCGATCCACTTCCGCGGGTTCGTT
CGCTCCTGGATCCACTTGGATGTCGTCAATCGTGACCTCATCTGTGGTCAGCGGTACCTCCGGGATCACCGCCAGGCCTTCTCCGAGATCCTCGGCGTGT
AGATCCCCGCCTTCATGGTAACATACTTGTTCATCTTCCGTCTTCGTCGGATCCACCATTGGATCCAAGCACCGCGACCCTCTTTCACCTGTCAGTCCTT
CTGTCTTCGTGGGATCAGGTAACCTGGTATCAGGGAAACCACCAGTTGGATCCAGATGGTCCTCTAACGAGTTTAAGCCCGACAGTTCGGGTTTGACTAG
TGTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAATGGAGAGCTTGGATCCACTTGTGGATCAGCGGGACCTGGCGACTCGACTTCCGCTCTCTGC
GATCCTCCATCCACCAACCCTGAGCTATCTAGGGGCCGGCTCTGGGCCCCCCCCCCCGGTCTTGGATCCAACCTCCACCGCTTGGACCTCAATCCGACGA
TCTCTCTGTAGGATCTTTCGCGGAGTTGGGTATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCCGGGGCCTCCTCTTCTCCGAGAGATTCAATCT
CGGTAGTCGCCTCGTACGCCAGATTCTGCCATTCTCTGTAACGACGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCCAACCA
CCGTCCGATCTCCTCATAATGGCCCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGTCCCCGGATTACGGTAGG
CACCCATTTCTCGCCCCGAGTGACCCACCGTATCTCATGTTCCACCCACTTTAACCGATCTGTCAGTTCCCAGGTTTCTCCGGGCTCGATCCAGGTCGTC
TTATCCGCCCTTATGATCCTCATCTTCGCCCCGTACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCCA
GATCCAACCTCACTCCGGCTGGTACCATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATGTCAAACCAGTACTCCAAACT
ACATGCCAACGTGATCTTGATCCGCGTTCTCCCGTTCGTACGGTACACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCAC
CCAACCTTACGAGCAAAGGCGGTGCCCAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGGTGATCTTGCC