Description :
From Genome Similarity Track
Location :
Scaffold_3912:17- 1552
Sequence
1535 bases(100 bases per row)
GTCTCATGGGGGAATCCAATAATGTAATATTAACTTCAATATACTTGGGATGTATGAGCGATGGGCTCCTGGCAAAATATCCAGTGGGCAGCTTTTCGTT
GATCATATCATTCTGACGTCAAGAAATAGCATTGGCATGGACTTAGCACTTGAGTCAAGTTCTGGTGGGTGTCCATGCAGCGGCGGTTTCATGATAACGC
ATTTGAAGGGCGGACCATCAGCAAGTCCTGGTACGTTGTACAGCGCGCTCGACTTGGTCGATGGCTACTACCAATTGCTCATAAGAGCGAGCGACATTCC
GCTGACAGCGGTAAGTACTCCGAGCGGTATGCTCTGGGAATGGCTGGTGATGGCCCAGGGGCTGGGCGAACGCATCAGCAACGTTCAATCGTCTTGTGAC
GCAGCTGTGTTAGGCCCCAACCGGGACGTACGCTCAAACGTACTTTAACGATATATTCGTCCATAGTCGTGCCGAGCACGGAAAGTCAGACGTGGATAAC
CACATTGACCACTTGCGAGCGGTGCTCGAGTGCATGCGCACTAATAAGCTGTATGCCAACTTGGACAAGTGCGTCTTTGGCGCGGAGGAGATACCTTTCC
TCGGGTGCTTCATTGGGAAGCGTGGCTTACGGGCAGATCCTGCCAAAGTCAAGGCCATCGTGGACTGGCCGGTTCCCAAGAACCAAAAAGACTTACGCAA
GTGGCTAGGCTTAGCCAATTACTTGCACAAGTACAGCGCGAACTACGCGGAGATGGCTCGGCCATTATCAGATCTCCTTAAGAAGGACGCACCATGGTGC
TGGAACGTCGAGCACGACGGAGCCTTTGAGGCTGTGAAGGAGAGCCTCCTCCAGGCTCCGATCCTTGCGCTACCGGACCCGGATAGTCCGTTTAGCGTTG
TCTGTGACGCCTCCGATTTTGCAATCGGTTGTGCTTTACTACAAGCAGACGCCGAAGGGCGTATACGCGTGATCGCGTTTGAGTCTCGCCAGCTCAAAGC
TGCAGAGAAGAACTATCCAGTTCATGACAAAGAGCTACTTGCAATGAAGTATGCTCTAGTCAAATTCAGGGTACACCTGCTAGGCTCTAAGCCTTTTGTG
ATCTTTACTGATCATGCGTCGTTAGGCACTGCGACACAGTCGCCTCATCTCTCTCAGAGAATGGCAAGATGGCTTTCCTTCTTTGCCGAGTATAACTTCG
AGGTGAAGTACAAGCCGGGGCGGCTTAACGTAGTGGCCGATGCGCTCTCGCGCAGGCCGGACTACGAGTTAGCTCATGTCACGACAGTGACGTCGTCAGT
ACCTGACTTGATACGCAAAGCGTATGCACAAGACGACATGTGCGTAGCGCTGCTACGGGCTCTTGGGAGCGAAGAGTTTAGAGACTCTGACAAGGAATTG
TCTGGGCGCTAACGCACGAGGCTGCATCGATACTCACACGATGGCGGCCTGCTGTACTACAGCACCGACGCTGAGGATAACCCTCGTGTAGTCGTTCCTC
ATGATGAGGATCTAAAGTATCGAATCCTCTATGAG