Description :
From Genome Similarity Track
Location :
Scaffold_3071:17- 1387
Sequence
1370 bases(100 bases per row)
ACCGACTGTGAACCGCTCGTTGTTCTTCCTGCCGCGCATGTCCGCCGACGCCTTCTGCTTGTCGACGGCGGCGGCTATCGCATCGCGCACAAAGCGCACA
ACCGACTGCCGCAGGTTCACGAAGGCATCGACATCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCGCGTCGTCGTGCGCGCGGTCGAGCACGTTGAGAGGCGGTGAGTCGGTTC
GCTGTACTGTATCCCGCGCCGGCGCACCCGCTGGCGCGGCGCTCGATGGCGACTTGCCCGGCGTCTCTCCCCCACCAGACTCACGACCGCCGATGCCGAG
ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGCGCGTGGGCGACATAGAACGGCGTCATGTCAGTG
CTCGCGTGCACGGTGTTGCTGACGGTGAACTCGGCCATCGGGAGGAACGAACTCCATGACTCGTACGACATCGCGTAGCCGCGCAGCACGTCTTCGACGA
CGCGATTCGCGCGCTCAGTCTGGCCGTCGGTCTCCGAGTGGGCCGACGTGGACATGAGCAAGCGCGTGCCGAGGAGCTGGNNNNNNNNNNTCATGCCAGT
GCTCGCGTGCACGGCGTTGTTGACGGCGAACTCGGTCATCGGGAGGGACGAGCTCCATGACTCGTGCGGCATTGCGTAGCTGCGCGGCACGTCTTCGACG
ACGCGATTCACGCGCTCGGTCTGGCCGTCGGTCTCCGGGTGGGCCGACGTGGACATGAGCAAACGCGTGCCGAGGAGCTGGAACAGCCGCGACCAGAACG
TGGCTGTGAAGCGCGGGTCGCGGTCAGAGACGATCGACTCGGGCATGCCGTGGTGACGGAAGACCGTGTCGATGAAGAGCGACGCCGCCTCCTCGGCCGT
CACAGACGCGGACACAGCCGCGAGGAGCGTCATCTTGCTGAAGCGGTCCACGAAGACGAGGATGCCCGTCCGGCCGCTCGCGTCGGGTGGAAGGCCAAAG
ATGAAGTCCATGCTCGCCGAACGCCACGCGTCCTCGGCGGCGGGCAACGACTGCAGCGGGGCCTGCAAAGACAACGCCGGCTTCACGCGCTGGCAAATCT
CGCAGGATCGCACCCACTTCCCCACTCACTTGTACATGTGCGGCCAGTAGTACTCGCGCGCAAGGGCGAGGTACGCCTTCTCGCGGCCTAGGTGGCCGCC
AGTTGCGCTGTCGTGGAACTNNNNNNNNNNCGAAGTCCATGCTCACCGAGTGCCACGCGTCCTCGGCGAC