Description :
From Genome Similarity Track
Location :
Scaffold_1325:17- 1381
Sequence
1364 bases(100 bases per row)
CACCGCGGTAGCGCCAGTGCTCCATCTTCAGTTCGCCACTGACGACTTCCCACAGGTCGCGCTCCTTCCAAGCACCATCTGCATCTTGAACTTCCACGTG
TGAAGTTGGTTCCGTCGAACTTGTTGATGCGGGCGGTCGTTGAAGTGGCGTCCATGGCGTAGGCGTAGTCTTGGGCAGAGTCTGCGGGGCTTGGGCTCAT
AACCAAAAGGAAGGTCGTTTGTGCACTAGATGATAAAATGCAAAGTGATTGATTTATTGGAGCTTACTCTGTCTTACGTCCTAGTCTGCATCCAATCATT
TGGTGCATCCAATCATGGACTCGTCCAATCATCCTGTTCGTCCAATCATCTGTTTGCGCATACATTTGTTTGCGCAATTGACTTACCGTAAACATCGCGG
GGTCCTTGGAAACCGGTTTTACTGGTATGCCGAAGCTGGACGAGACGCCTTCTTGACAACACTCCCACTCGACTCGACCGCGCTTGGTGGCTTGATACCC
AGCTTGTTGCGAAGATATTCGAACTGCACCGCGGTGATCGGCTTGGTCATCAGATCCGCCTTCATGTCCTTCGTCAAGCAGTACTGCAACACCACTTGGC
CATCATCAATCTTCTCGCGCACGAAGTGGTAGCGAATGTCGATGTGCTTGGTGCGCTTGTGAAACTCGGGGTTCTTGGCCAGCGCAATCGACCCTTGATT
GTCCTCGAAAATCATGACAGAATTCTCGTTCTTCATTTCGCCGAGTTCACACAGGAATGCCTTGAGCCAGATCGCTTCTTGAGCAGCTTCCGTTAACGCC
ATGTACTCCGCCTCCGTCGATGACAGCGCCACCGTGCGCTGCTTCTTGCTTCTCCAACTAATGCATCCGCCGTTCATCATGAACGCGTAGCCGCTTGTAC
TGCGTCGAGTCTCGACGTCACCAGCCCAATCTGCATCCGAGTAGCCTTGGAGTCCTTCTTCACTTGTTTCTTGAAACTCGATGCCGTGCGTCTTCGTACC
TTGAATGTAGCGAAAGACGCGCTTGAGTGCTTGCCAGTGTGTGGGACACGGGTCCGCCGCGAACTGGCTAAGAACTCCCACTGCCGCAGCGAGGTCCGGT
CGAGCTCCAACCATGAGGTACATCAGGCAGCCGACAGCATTGCGATAAGGCACCTTGGCCATGGTCTCTTTATGGTTGCATCCTCCTTCGCACATGGCCT
TGGTCAACTTGAGTCCTGGGTCTTGAGGGGTCTTGACAGGGTTACTGTTCTCCATGCCAAACTTCTCCAGGATGTCCTGACGCACCGACACTTTTCCTGA
AGTCGCATCTTGATCGATCTCCATACCGAGGAAGTACTTGAGGCAACCCAAGTCCGTCATGTCG