Description :
From Genome Similarity Track
Location :
Scaffold_102:17- 1245
Sequence
1228 bases(100 bases per row)
TGACTTGACACTGAAACACCAGAGAGGCTGCTCGGCGTGAGCTCTCGAATGTCATCGCCTGGACCGATGATCTTGAGGACGCAACTGACGCTGCAAAACC
TGAACTGAACGTGCGAATGGTCTTGATACCGTGAATAAGCAGGCAGGAACTGTATCCAACTACATTTAGGAGAGTTCTGTTTTAGTGCAGAGCTCGTTAC
TGCACAAGTGATGGACTTGCCGTCCACAGGCGTTGCAAGGCGATGTTTTCTCGAGGTTTCCCCAGGCTGCTTTAGCGCACTTCATCGTGTCCTGGAAGCT
TGCTAAAAaagagggggggggcggaGAACCAACTGCGTGCGTCGTTCGaagatccagcgctggttgaagctcTCCCACGATAGTAGTTATATATTCGAAT
ATATTACTGACACTTCAGCAAGTGCACGACTATATCTATATCACTATCAGTGATATTGTCACTGCTATAGCTACTATTTTGAAaactactaccaaaccct
ggTTATTACTAATAACCAGTTCGACGTCAAAGCTTGATTCAGGTCGTTGTTAGTGACTCGTCGTTATTCTTGTAGTACAACAAACTAACCGCGAGTACTA
TCTCGAGTCTTGGGCAGATTTGGCTCTTGTCAATCAGGAAGTGAGACGTGTGGGGGAGGTGACGAAATGAAGTATGCCTGCAACTGGTGGAGTGTTGAGC
ACTTGCATTAGTTGCGACCAGCAACTGCCTCTTCGAGATACTTTCCTACTACTCGCAGCTAGAATTCTCCAAATTGCACAGTTGGGCGTTGTGTGAGGGC
GGTTGACCACAAGCAAACTCATTACCCCCGAATGTACGTTGGCAACACAACGTGCAACACCTACGGTAACTACAggccactgctgccatcaGGCTACTAT
TTGGTTGGGAATTTCCTGCTGATTCAGCAGCATCGCAGGATTCTTTGTCTGCAACCGTCAGAGTCAGGCTcgtacttctccagcgtcCTCAGCGAACGTT
GTTGTCCGCGTCATGATACAAATAATGCATCCCAGACTGGGATGCATTAATCGCGTACTGGGAATCCCAGTCAAATGGAGATATTCGCAACTATCATACT
CGACAGTAGGTGGACTATGATGTTTTGAGCGTACATAGTGATCATCCACACAGGAGCCTGCACCGCTGCAGCGATGCGCAGTGATTTTGTTTGACATGTT
CAGTCTCCCTGCACGACCACTTTCAACT