Description :
From Genome Similarity Track
Location :
Scaffold_14:169942- 176395
Transcript NameFunction/comments
Physo_308821glycoside hydrolase, putative
Physo_246550predicted protein
Physo_533839AlNc14C79G5211

Sequence
6453 bases(100 bases per row)
GGCGAACAGACAGGAGGTTGTCGCCGTTGAGGGAAACTACCTTGGACAGCGTGGAGACGCCGAAGTCACCGGGCCACGGCGTGCGGTCGCGCTTGGCGCC
GTCCACGTATACCTCGGCTCCGGTAGTCACGTTCTGGATGGTGGCATTGTTGAACCAGCCGTACTCGGTGATCGTCGGCGGGTTGGCGCGTGACTCGTTC
GAAGCGATCGTGCACAGCTGCACGGTGTACGCGCCAGCATACCAGATGCGGTTGAGCAGGTCGTCGTCGCTGTAGAAGTAGCCGGCACTACGATACCTCG
CCAATTTTTTTTACACCAACCTAGCAATATAGAGTCTGGGACGGAGTAACTAGGTTACGCGAAACACGCAACTCATTTCATTTCATTTCATTTCATACGA
TATCCGAGGTCAAAACGAAGGGCAAAATCTCTGCAAGGCACAATAAATGACTGTAATGCATCTCACATGAAATCAAAAACGAGTCCACTAACGGGAATGG
GAGGGGGGGGGGGGGGTTCAGGCCGGAGTTGAGGAGCTAAATGCTCTGAGAAATACAACCGCAAGTAGTGCAGCTCACCTCCGAGTCTTGAGCTCATCGC
CCGTATCTCACGGGATGAGATTGTGTGGTGTCATTCGTGTGCTGTGGACAGAAGCAAGGAACGCCGTGATTAATCAGGCGGTTGGTGGCCTGTCGATCTG
AATGATACAGCTATTTTTGCTGGTCAAGCGTATCTCAATGCCATCGATCGATCATCTCTAACTAGCTAATAGAATCTCCAGCGTCGTGCTCGCTGCAGCT
CGAGCATCACGCCTCGCCTACTCTCCGCGTAACCATTCTGGAAAACACTTCCAAGAGCTCAAGCACCTAACTCAAGCGACCAGAGGCGCCCCACCCCACC
TCACCGTCAACCGTTCAACGACCCTCATCGAACCCAGCAACACCATGAAGATCCTCAGCCCGACCACTTTCGCGTGTCTGCCATCAAGAATTTCGCTCCA
CCGCAGCACGGCTCCGGGTCGGCTGAGATGGACCACATCAAGACCGCAGCCAACTTCGACGTCCAGGGCGTCCAGATGGAAGTCTGTCCGTCGGGAGACA
GCCAGACCGGCAAGTATATGCGGCTCTCGGTCACGAGCCTCACCGAATTGGACACCAGCGGTGCCGTAGTGGCGAGCGTCGACAAGTTCAAACCAAAGGA
CAGTGACTGGACGGACATCGACACGGCCGGGTGAACGGCGCCAGCGTTTCCTCCACGACGTTCGTGTCGACTCTCGAGGTCGGCGTCGCCAAAACACAGG
TGGCGTTCAATCTCACTGCCAGCGTCTACCAGGGCAACGCGACGGTGCCATACGGCAGCCAGACCATCCCTGTGCCAGCGGGCGCGCTCAAGTTCACCGC
CGATATCGCTGGCTGGCCGTTCGCCGCGACCAGCAACAGCCTCGTGCTAGCTGTCGGCCTCGAAAACACTCAGTAAGCCCGTCAAGAAGCCCAAGAACGT
CAGCGACTCTGTCGGAGACGCCGACATTGAGCGGGTCGATCTGGGTGACTCCATGTTCATGGACGTGCCGAGCCTTGTCATCCTCGACGGCGGAGTCGAA
GAGAGTCTGCTCAACGTGTCCGTGGTGGAGGCGGCGGGCGACACGTCGCTCGAGTGGATCTTCCCGTCCTTCTCCACCTCGCTGCACTACGACCCAGTTC
TGGGCGGTACCAGCGCCACGACGGCGACGACCGATAGCGGCGTCAACGCCGGTGACACCAGCGGCAGCACTAGCGACGTCAGTGTTGGCGACCCGAGTAG
CAATGACGGTAGCGGCAGTATCAGTGTCGACGCTGGTAGCAGCAGCAACAGTGAAGGCAGTGCCGGATCTAGCAGTAGTGGATCCAGTACTAGCGCCAGC
AGCACGAGTGCGCCTAGCTCCACCCCCGCGCCAACCACCAGCACCAACAGCGGAGAGGGCACGAAAGCGCCGACCGCGACAGCAACCACCGGACGTCATC
GGCCACTTCAGCGTCTTTGTCGGCTCTAGACATTGGTGTCTTGGTGGCGGTCGTCTACAGCCTCTTCTGAAGACATGGGAGCACCGGCGGTAGGAGAAGG
CTGGGGGCAACCCCAGCTATTACATTGCGGACGCCAGCGATCCATACAGTCATATCTAGTAGTTCTGAGCTACAGTTCAATGCCCGTAGGGCAGTCGATA
ACTCAATGAGGGGGGGGGGGGTAACGATTAACCGTGTTGTTGGTTATCTGGACTTCTCAATATGCAGAATTGTACACTAGCTATCATACACAAATGTAAA
TCTGGCGTCGTAGACTACAACGGTGGAGCCCGTAGGCGCCACGAGGCGTTGGTATAGAGGGCAGACTGCCGGAGACTAAATAACCGTGGGTGGGTTGCAA
TGAAGCGACCCAAGCAGGATGAAGTAGGGAGCTGTCGGAGGCATCGGCGAAGTCTTGCTCGGGTTGGTTGGTCCCAGACCTCGGAAAATACAGTATCATA
TAAAGCTCATAATAATCATTTTAATATATCATTCACCAATAATATGTATTTATTTCAATTACTTTTATATGGAGATCCCGATAAACTTGGTTTTTGTATA
GTTAAACATTTTACTGAAAATTGGGCTTCAATAATACATATTTCCGTACACAAATACAGTTATTGCAATGAAATAGTTATTTTTTCCAAGGCCTGGTTGA
TCCGACGACCGCAAAAGAGCTCGAAAATGAGCGCCAAAGACAGAATAAACTCGATAGATCGCCGTGGCTGGGTCAAGTGGAGGCCCATCCTCGAACTGGT
GTTTATTCCGGGCTGTCCAAATCACGTGGATTACGATGCAACGCGTGATCGTCCAGAGTAGTGACAGTTGCTCCGCGCTCGACACCCTACCAGCTGCCCA
GTGGGGCTCCTCCAGAGTACAGATCATGGTCCAGGTGACAGAACCATCGACAAAGTTGGTCCAGTCCAGCATAACGACGGCCCAAAGCGCTGCTGCGCGA
GAGCAGTCCAGGAAGATATGCTGTGCTGTCTCCACCTCGACACAGTTGGGATACCCACAAGCAAGATCACTGAAGCCGGGTATCCGTAAGAAATAGAAAC
GAGATCGTGTGGGGAGCAACATCCAGCTGAGGCGGAACTGCAGATCGGAGTAAACGGGAAGGACAAGACTGCGAAGAAGTTTAGTCGCCGCAATTGTCGC
GGCCATCTTTGAAGCATTGGTACCGGAAACTTGGTGTGCGAGTGGGTGATCGCAGAAAGCAAATTGGGGGGACCCAATTAGCCGCCACACATCGGTCTTC
TGTAGCCTTGGAAATCGAATAACTTGCTGCTGACGACGAACTCCGACCAGAGGAAGTGATGGTGTTAGAATGCAGGGACCTTCATGAAGGCCGCCAGATC
TCGTAACATTGCCATAAATACTACTCAGATCCACGTAAAGGTTCATCAGGTGCCGAATACGATATGGTAATAGAGGCTTTCAGAAGCACGTATTTTTCGC
AAAAACACGTAGCGAAAAACACGTAGCGATCCGATCTATTTTTGGCACGGGCGACGCTACGTGTTTTTCGATCCCGTAAACCCGTGAGAGGGGAGTCCGC
TACGGGGTAATCAAACTGAAATATGCGTAAGGAAGCAGCATGCCTAAGCTTCTTCGTTAGGGTGGGTGGGGGGGCCTGGATGACAAATAGTTGGTCGTGG
GCGCATTTCCCGTCTGTTAGAGGCTGAGTGCTCCTCGTTGGCGACCTTAGCTTGCGTGTGTACTCCATTATCTGCTGCTATCGGCCTGTCAAGATTCCAT
CTGCCCACTTGTCATACAAGGACCAGCATGGGCGGCCGGTAGGCTCCCCCGCCGCCCTAAATCAAGGCAATGGGCGAGCAGCGCCTTCCAAACCTACCTG
GGGTTTGGAGAGACCACAGCCGACACGTCGTATTGGGACCACTACAGCTACAAATGTCAGGAAACCATCATGCAACCCCCAAGAAGTATGCATCCATTTC
TTGAACTTGGTGAGGCGTCGATTTCGTTGCTACTTATTCCGGTGCCAACTCGCGGCATGCTGGAAGTATCGAGCATCATACGCCAGAAAGCGAGTAGACC
AAACTATCATGGACCAACAAAATAACTTTACAAATTGAAACTTACAACACCCAACGTAGGTAAATTAGATGAAGACGCTGCGGACAACCGAGACACGTGT
TCATGGTGGTGCAACACCAACAGATTCATTCAAGGCACGGAATGAACATGGCTAACAGTAAGAAGGCATTAATTAAAAAAAACGGAACATTTTTTACTTT
ACTTCACTATACTGCACATCTACGTTGGCCCAGCGATGGCGCGTGGGCGTAGGCGCTGTCGACGTGTTCGCCGAATGACGGCGCTCACAGCTAAAGTTTG
TTGAGCCGAGGTTCCAGCTTAAAACGTTGCGTGCACTCGGAAGATTCCACGCTACGTATTTTTGCCACAGGTTTTTGATTTTCCGCTGAACAGCCGACCA
CTACGGAAAACCCGTAGTCAAAAACACGTATCAGCGCTACGTGTTTATCACTGCGTATTTTTAGAAATACCGTGCTTCTGAAAGCCTCTAATGATAGACT
CGAGACCACCAGCATAAATCGTGACAGAAAAGCTGGAGCCTCAGGCCACCCAGCGTTCATGAAAGCGTGCAGACTACGACATCCGGTCTCAGCAGCAAAT
TGCATGCGAAATTTCCGCGTCGCCCCCGCCTTGCCTAGAAGCGTGGCTGGAGCCTCCCCACCGTGCCCCAACATCAGAAGGGGGTGGGTTGAGTGCCAAA
TATACGAACGCAGCAAAGATACTTGACAGTGAACAGGGTCAACGAGATCACCTCGTTGAAACCACGCAACCGTAGACCACGCTTTCCATGTACGTTTCCA
TCATGTAGAGAGGAGATTGACTCGGACCACCGCCGATGGAACATTATACGGACAGGTGATAAAGTCGAATGGATGCTCCGTGGAGCTGTCGATAACTCAA
TGAATGAATTGCATTGGACGCTTAGCCAGATACCATACTATCATGGTAGTCCTTTTTACGATGCCTAAAATGGCCAAGCCTTTTTGAGGTGCTTGGTGAA
TGCACTGTCAATCAGCGGCACTGTGACGCTAATACACGAGAAAGTATCCCCTTTCCAGCCAGTGTTGTTGAGAGCACCGCGTGCCACCTCCGGTAGCTGC
TCCCACGTGACAAGAGCTTGGAGCTCGCCCGCTTCCTCGGTAAACTTCAGAGCCGTCTCGTGGAAACGAAAACTGGCGTAGTAGTACGCAACTTTCAGAC
TCGTGCCATTCAGGTACTGAGCGAGCTACCGGAGGGGCCTGACTCTTGTAGCCTGTTTTCTCTGAAACCGTCACGGCCTTGATAGTCGGATTGTTCAACT
CCGGGTTGTCGATCCAAGCAATGACGTATTCCCAGTTTGTGACGATGAGAGATGCCAATCCCTCTGTCAGATTCCGAACCTTTAGGGAAGTACCAGGTGT
ACATAATGGCCCACACATCGTTGTACCAAGTCGAACGGGAGTAGACCTGGGAGCCTGTGGAGAAGTGCTGAATATGAATTGTTCTCTGAGAAAGGCGGCA
AGGCCGATCGACTGGAAGTATGGGAGATCAGCGATCGAGAGACAGGCAGCAAGGATCTGTGGATCAGAGGGGGTTCTTCGGGAGATCTCATGTGGCCCGA
TGACGCCGGCGCGTAAGGCAGGACATGTGGCAAGCCGGATTGTGGATGATCGTGCTCGAACCGTGGCGTGATTCGGGGTCAACCCAAGCCCCGATCGACG
ACAGATCTCGCAGATCTACGACGGCCGAGGACGGAAGATGATGGATCGGCGGCGTGCGGCAACCGGCACAAGTCGTCGATCGCAGATCGGGAGTCGATCG
CCGATCGGGAGTCGATCGTGGATCGGGAGTCGATCGTGGATCGGGAGCCAATCGTGGGTTGATCGTGGATCGGGGATCGACCAGATGGGATGCACATGGA
GGACGAAGTCAGGACAAGAATCCAGTGGTTGTGGAGTTGTAGGATGGTAGATGAGATGGTAGCGGTAGAGAGACACCAGCTAAACATAAATCAGAACGCA
ATTTGCACAGAAGACCACAAGTACCCTCAAGTCGTCAAGCCCCAGGAACTACATTGACCTCGGCAAGCGTTGACACTTCAGGTAGTGAGCTAGCGGTACG
GTTAAGACTGGATTAATACATTGGCCAGCTTGACCTACTCTAGTGATCTTTTTCTCGTGTGCAAGTCCTCGATCGACCGGATACGGCTTGGCCGGCGATC
GCTGCGTCTCTCAATCGATCTCGATCCCGCTAGCGGCAAGCAACTCAGGAAAGGAAGGAACACACCCGGAAAGGCAACTACAGACCGTGGATCGACTCCA
GGCCGACCGATCGGAGCGAACAACCCTCGATCGGAGCGTATACTCGGACGCAG