Description :
From Genome Similarity Track
Location :
scaffold_457:16994- 19755
Transcript NameFunction/comments
g8531.t1hypothetical protein

Sequence
2761 bases(100 bases per row)
TGGAGAGTTTGGCTAGGATGATTTCTTCCGGGTTCTGCTTCTCGACTTTAGTCACGAAGACAGCCCACGTGAGGAGCTTTGGGTCTTCGAAGATCTTGCT
GCCCGCTGTATTGAGCCCGAGTTTCACGAAGGCGTCGTCCGTAGACGTCCCCTTTACCAGCCAAGCCTTGATACGAGCGCTCTGGGCCAGTTTCAGAGCG
GTGGACTCGAATAGATCCGCGAGTTTCCCTGTACTGGGCAGGGTAAACGCTCTCTCTTCATTGTCGTCAATTGTTCTCAAGAACCTCGTGATCTGGAGTG
AATTACCCGCAGGGACGTTGAGTTGGATAATATCCGTCTTCTGGGAAGCTGAAGCTGCATCGAAAGTGGCAAGGAGTGCGGCAGTAGCCAACAGGATTCC
ACAGTAAACTCGCATGACTGGGCGTCCTTCCTTTAAACCGTAGTGAGTGCACAGCGAATTGCAAAGTGATCTGAACGCCTTTCGTTGAAGGAGTATCGCA
TGACACAGAGCATGATTTCCAGCGATGAATCAGCGGATGGGGAATCGCATAGTCAAACTTCAAATGTGGCGTATAAAAATCGTGAATCTGGGAACACGCC
TTCACTCAAAGTTACACGCAATTACGGAATTACGTCACGTCGTTCTGTATTGATTGGAGCCGCCCCCACGAGCTAATTTATCAAAAAAAAGTTAAATTTG
TACTTCGGAACTAAGCATGTGTATACGGAAGCAACACATGAAAGTCAGGTGTGTTGAGCAAATGTACAGTAGCGTGGTCACCACGAGTTCTTCGTTCCCT
GCTGCTCGGTATCCGCGCGGCTTCTTCGTACACAAATCATTCGTGACTTGTGTTGACGCTGTTCCAGCGGATATTTGGTTGAAAAGGCATCGAAATCAAT
GTTTATGTGGTTCGTACTGTACTCGCCTTCTCAACACAAGATCAATGATCAAGTTTACATTATAATTCGAAAATGTACGGGTGGATTGACTGTACTGTAC
TGCTTCTGCTTCTGCCAAACTTGTACAGACGCTTGGTCAAGATTGCGGGTAACTTCAGCGACGAATGCCGAAAGCACCTCACCCAGGGCTGTCTGTACGA
CGATCGATTTAATAGAAGCATTTCACTCTCTCTTCTCTTTTTTACATTTTAGTACTGGTAATTTTAATGCACTTCAAGCATGTGGAGAGTGATGATCACT
GATTCCCTAGCACTAACGTGAATACATCATCAGCCGACTTAAGTTGGCGATTGCTACTTTTTGCGCAGTCACGAGATGTTAATGCGGGTTGGAAACAACA
GCACAAAGTACTATTGCTAGTCCACACAGCAACTGTTTTCCATGCTACTTGGCGTTTGCGAACAAGATTCACTTCAAGGAGACTGAAACAGAACAAGTAA
GCACTCAAAGTTTGTTGAACTCATTTCATCGTCACTGTCAACACATCTACCTGCATAGCGAGGAGCTCGAGTTGAACGGCAATGCAGTGATTTCAGTTCT
TCAAAGAATGGGTATAGATCCACCAAAACCAAGAAGCTTACCCCAACCAAGTGACCGAATCTGGATTCTCCGACAATAATCAAGAAGTCTAAGTAGATAC
AACATAGCTAGCAAAACGACAAGTCCACTAACTAGTTAATCAACTTCTTCTTCTTCAAGCATCATTTTGACTTTTTCTTCCTCGCCTGTTGAGCCGTGTT
CGTGTGGTAATATCGCAGTGCTCACTTCTTTACTGTCGCTGGAGCAGCAGCAACAGATAATATCTCTCGAATGAGCTAAAACCAAATTCCTCTATTATTC
CCCAATCAGTTGACGCATGTATCACTTTAACCATTTCTCGCCTTCTTGTAGGCTGCGGCGTAGCGTTCGTAAAACAAACGAAAGCCGTCTGCCTCCTCTC
TTCCTTCAACTCGCAGCCATTTGTACACATTATCCGGGTGCACTCGATTCTTGGGCCATCGACCAACCAATGACGTTAATAGTTTCGTCGCTTCCTCTTT
TGTCGCTGGTATCCCCTGTGCGTCTGTGAGAATTCCGGCAAGAACCTCATCACCAAAGCGCTTCTTCAGTAGCGAGGTGACACTCACTTTCTGCCTTCTC
GTATTGTAAAAATTCGCGTAATTTAACCACGTGAGGATCACAGGACTCTGGAACAGCTTATCGCCAGCTTTATCCAACTCGAGCAGACTGAAAACACGCA
CAGGGGACTGATGAGTGTTGAGCCAGTCTCGAAATTGCTCAGTATTCAACCGATGGGCGATACTGGACGTGCTGGGAGACTTGGAAGCCTCTGCGATCAT
TTTCGACACTGCTGTAGCGGGGTAATGATCCGAAATCGTCGCGATTGGGTCAAAACTAACCTTGGGGTACATCTCTCGGAAATCGTCCGCGTATTTAACC
CACGCGTCGAAGATTGGGTTCTCAAGTAGGTTGTTACCCTCTCTGTTGAGTCTCAATAACGTGAATAAATCGTCCGGCGTCGTCTCCTTCAAAAGCCACG
ACGCAGTCTGCTCGGCTTGAATGCGTAATGCGATTTTCTCGGTACTGGCGACGCTCTTGGCCTTTATCAGCATATCTGCCAGCATTCCTTCGTCCAGAAG
AGGGGAAATTCTGGCAAATAGAGTAGTTTGCTGGTCTGGATACGCCTTGTTCCAGTCGTCCAAGTACTTGACCCAAGTGAGCAGTTCCGGTCTCTCAAAG
AGATCGTACCGATTCTGATCAAGTTTCAGCAGGGTTAAAACTTCCTTTGGCGTCTTCTCCT