Description :
From Genome Similarity Track
Location :
Scaffold_30:16992- 18627
Transcript NameFunction/comments
g9658.t1hypothetical protein

Sequence
1635 bases(100 bases per row)
TGACCCCGTGGCTTCCGCCGGGCACGTCACAGCTTGGTCTGACGAAAGCCGAAACAAACCTTCCGTCGACTTCCACACACGAAACTCCGCGACCCCGTAG
CCTGACGATATCCTCGCCAGTGATGCTGGACACATCGCCAAGGTCGCCACTTCGAGAGCTGTCTCCTCCCTCACCGCGCCAAGACCGCCGCGTGGCCGCC
ACACCGTACTGTCGCCCCCGCGTTACGTCTAGACAGACGGAGAACCGCCGCCGTAACCCCCCATCATCAAAGACTGCTTCAAAGATCGCTGAGACCCTTC
GTCCGTCGCGGGCTTCAGCTCTTGGTTACGTCATGGCTCTCGCGAAATGGCCCAGTCTCATTCCCCAGTTGCGGGCGCAGTTCGACCCGCTAGCCAACGT
GTTCCCGATCGTGCCTCACTTTGGATGGTGCTCATCGCCTTGCCGGACGGATCGGTGCTCGAACATCAAAATGAAACTGTTTTGCAACGTCAATTGTTGC
CCCTTCGACGGCTTGTGTGGCAACGGACTCGCAGAGTCCGACAAGATCTGCCTGATGCGTAACACGCGCACGTCGTCGCTGAGCGTCGTCGCGGCTGCGG
ACATTGGACCAGGCCAGGTGTTGGGCCAGTACTTGGGAGAGATGGAGCACGTCCTCATCTCGAAACGCGATCGTCCTCCCAACCACGGGTATCGATTGAT
GGTGAAGACGCGCCCGGAGTTGCTGGCGAGATCGGTGGTAGTGGCGATCAACGCCGAAGGAACGGGCGGCTTGATGAGATTTGTGAATCATTCGTGTGAG
CCCATAGCCGAGTTCCGGGAGGTCAGCAACGGGCGCCGCCCCTCGGGCGTGGTTGCGACGACAGCTTACGTTCGCCAAGGACAGGAGATCACTGTGAACT
ACGTAAGCGATCTCTGGCTCATTTGCCGCTGTGGATCTGACGTGTACTGTCACCGCCACCACCAGGATCATGCCGATCCGTAGCAAGTGTCGAGCAGCGA
GGACATTGAAGGGCGAGGTGACGATTGTCGTTGTTTGATTTGCAATGCACAAGTAAGTTGACTGATTCGTATTCCGTTATCTTCACGAAAGGTTGCATTC
GCAAGACACCCGAGCCTCTCGTTGATTTTGGCGCCAAGGCCGCCAGCTCCTCACACCGCGGCAGGGGTTTCTGGCACGTCAAGCCTCGCCGCGTCCAACG
ATTTGACTTTTGGTGAGAGACTTTCGCGCCAAGAAGCTTTCGTCTCGCTACTTTGAATCTAATGCTACAAACGTGGGCGGGAAGACGGTCTCCGACGCGG
GAGTCGTCTTCATTGCTCACTCTTGGTTTCTCCAAGTACCCGACAAGCCCTCCACCACCGCCCCGCCCTACGCACTTCAACACCTTCTCACTGTACGCCA
CTCAACAGCGACTCCGCTCTACGTGCCATACGACTCTAACTCTGTTTGTGTTGTCGTTATTAGATGGTCAAGTTGACCGGAAGCCAGAACTACAAGATGC
CCGAGATCTCCCGCCTCTTGACGGTCATCAAGGAGCTGTTGCCGCTCGGGCGAGACGAGTGGGAGCGCGTCACGATCGCCTACAACACGAACCGGAGCCG
TTCGTGGGCCGAGCGAGACCTCGACAGTCTGCGCC