Description :
From Genome Similarity Track
Location :
Scaffold_152:16992- 18342
Transcript NameFunction/comments
Phymu_g5600hypothetical protein PHYSODRAFT_396891

Sequence
1350 bases(100 bases per row)
CCTTCGGCATTCTCAAAGCACTGGGCGTGTGGAACTGCTGCCTTGAACCACTCGATCTCAGCGTCGAAATCGGCGTAGTCTGGATCCTTGCGTCCGAAGA
AAGCAAGCACTTGCAATGTCGGGTACTTCCCGAGCTCGGTAAGAGTAGAAGCGACGCCGACTTTGCTAGCACGAACAAACTGGCCGACGTTAGCAATGTT
TCCCGCCTTGGCTTTCAGATGTCCTCTAAGAATTTCGAGCTCTGCGTCAAAGTCGCCAGGCAGCTTCCCCGGGAAAAGAGTTTTGTAGTACATCGCCCAG
ATCGAAGCGCCGTACAACGAACGGAAGAGCAAGTGTGAAAGAGGTCGAAACCACGAGTCCATGGGTGAATCTCGCAAAATCGGCCCGAGCAACACCAGCG
CAACGACGTGGGGTCTCCCCGATAGCTCTCTTTTAGCcgcctcagcagcaagaacCATCGATCCGGCACTGAGGGAGTTACCCAACAGCACGAAGCGGCT
TGTCGGGTCGGCAGAGTTCAAATTCTCCATTAGTTTGGTGACATCGGATGCAACGGATTCAGGGGAGTAGGCGGAGTAGTCGTCTGCTTTGTTATCGTCG
AACGATGTCGAGTCGCCGAAGCCTCGCAAGTCTCCGAGCATGACACGAAAGCCGAGTTGGTCATGCAGCAGTGGTGCCAACAGGCGGAACTGGCGTCTGG
TGTCTCCAATACCCGGTAGACAAATGGCGATGGTGGTACCAGGAGGACTGCTGGGTCGCGAGtcctcgaagaagacgtagGATTGAGGCGAAACTTGGTG
GCGGTAGTCAACGGAGGAAGCGAAGACTCGTGGAATGGTAACTTTCGCCTTAGTCTGGGTCGAAACTGAGTTTGACATTGTCAAGATGTTGCTGGTGTGT
GCGGTTTGTGGTgaattgaaaagtgagttCGTTGTTGAGACTTTGCtagaagttgaagtggtagGGAACGCCGCGGATTGGGTGGATTTTGATTGCTTCG
TTTTCGAACACAACGTGAACTTATCTGATATTGTTTCAGTTAAGTGTCGACTGCTCTTAGTGGGTACACTGTATCGTACTGTACACGGTACAGTACCCAC
AGCATGTTGGTGACCATGgtactgtacgtgtacacTGCAACAGCCAAAAGATTATTAGAGAAATGAATCCGGCGAAGGAACATGTCGCCTTCATTTATAA
GAACGCATGCACTACCCGTGCTTTTTGGCTCCACGGCTGGGTCTAACCGTATATGAGTTCTACGAGGCCACATCTGTGAACGCATTTGTCGTTTTCACGT
GCTGAGCGTCTTTAGTCATTCGGGCACTCCGCATTTAGGGGCACATCCAT