Description :
From Genome Similarity Track
Location :
scaffold_132:16990- 17993
Transcript NameFunction/comments
g4280.t1 HECT E3 ubiquitin ligase, putative

Sequence
1003 bases(100 bases per row)
TGCAGGAACATCTGAATATCGGGTTCATCGGTGAGCCAGCGCTGGATGCTGGTGGCGTGCTGCGTGAATGGTTCGGACTTGTGTGCAAGGAGCTTTTCAG
TGCTGAGCGTGGTCTTTTCGTGACGACACACGCGGAGGATTCCAGCTATTGGATCAACTCCGAGTCCGCGAAGTGTACACCGGAAGGTCAAGATCATTTA
CAGTATTTCACCTTTGCTGGAAGACTTTTGGGCAAGGCCATGCTGGACGGTCTTGTACTGGAAGTGAGCATGTCCCTGCCGTTACTGAAGCATCTCTTGG
GCGTCCCCATTACGTTCTCCGACCTGGAGTTTCTGGATGAGGAGCTTTATAAGCACCTGTGCTGGGTGCGGGACAATGATCATGTGGATGCTCTGTGCGT
GACGTTCAGTATTCAGACACCATCGGGTGTCACTGTGGAGCTGAAACCTGGTGGAGAAAACATTGACGTGACGGACGAGAACAAGATGGAGTATTTATCG
CTTGTATTACGCTACCGCATGTTGGATAGCGTAGCGGACCAACTCACTGCGCTGCTGAAGGGTCTGTACGAGGTCATACCGAAGTCTTTGCTGACTATCT
TCGACTATCAAGAACTGGATTTTTATCTCTGTGGACTTCCTACGCTAAACGTGTCGGATTGGCAAAACAATTCGCGGGTTCGACATGCTGCCCAGGATGA
TGATACTGAAGGAATCGAGCAGGAGATCGAGGTAATTCAGTGGTTCTGGGACGTGGTTGGTGCTTTCACAGACGACCAGCGTGCCCGACTATTGCAGTTT
GCCACTGGCTGCTCACGTGTTCCAGTCGAGGGTTTTAAAGCACTTACGAGTGCAAGCGGCATTGTGCACCCGTTCACTCTGCAGATGGTGCCCACAGGCA
CTCCTCCGCTTGGTATGTGTCCACGCGCACATACGTGCTTTAACCGCATTGATTTGCCTGTGTACGAGACCAAGGAGGATCTCAAGTCGTATCTATCTCT
GGT