Description :
From Genome Similarity Track
Location :
Scaffold_423:16989- 21688
Transcript NameFunction/comments
Phyag_g5592HECT E3 ubiquitin ligase, putative

Sequence
4699 bases(100 bases per row)
CTTGCTTGTGGCATTCGCAACCAACAGCCTGGACACATCGGAGTCCATGAAGAATCCTGTCGAATCAATAACGTAAGGTCCACCCTTCCTAGTTCTGGCT
GGCTGAGCCTCAGCCGCTGAGGTGATGCCGTAGTCGGACAAACCAAACACGACTTGTCATCGCCTTCTCAGGCAACCTCACCGACTGTGTTCAATTCCGA
TCTTCCACAGACACGATCATTCCATTCGAGTTCATCAAAGGCGACACTCTTGCTCATTCACCATTCATACAGGTCATTCTCTCCGTAGTCTGCACTGCTG
TGGACGGCGATACTTCAACGCGCATTGCCAATTAGAGTGAAGGCAAGCGAGACGACAGATACTTGAACATGTAAAGTTACGCTTGAGACCTCCCATTTTC
GAGGAAACAGAGTTTTTCTTGATCAGATTGGTGCGGTATGCCTTATTCCTCGCTTGTGTAGGGCACAGCCACCGTAGATAAGCAGAATGATTATCGCCGA
GCAAGACGGTCAGCACAACAACACCATGGTTCACGACAGTTCGTGGTCGTTCACTGCGTAACTTCTTGCAGTGCATCTGGTCAACAATCCAAGGTATCGt
cgccaacgccgctctCACACAAAACCATTCACTCTTGGCAAGAGCCTCTTGCTCTCCACGAACGTCGACGCGATTTTGCgatgcacttgctgcagGGGGA
AGTTGCCTGTCCACAGCCGTAGCAACGTTGTCTCGACCGTTTCTCGATAACATGCGTAGATCGTCAGCCAAACGACGAAAACGTAGTTGCGGCAGCATGT
CCACGTGGCGTCTAGCATGAACGCAGCGTAGCGTATTgtattgtacatgtagcaggCAGGCCCTTCTCCAGATCATGTATcatgaactgcagcttttcgA
TCGTCGTTTACGATCTGATCGTCTTCGCGATGTAGCGACGCAATCGGATCTTAATCGAAACCCCGCTCGTCTCACACAACAAGCGCCTCCTTCCTGGCGC
ACTGCTGCTCTCAAGGCAGAGACGTCACAAGCGGCTCTTTCTCTTCTCGCTCCTAAAGGCCACAGCCACCTCTACATCGGGCTCAACACCAAACCATCCG
CCGTCATTTTCCAACCACGCCCTGTCATTGGCTAAAAGACGCGTCAAATTTTGCAATCCAACGCCAGAGTGTCCAGACGCAATCAACTGAGTTCCGGTAG
CCCCAGCTTAGTATATAGGTTCATCTCAGCTTGATCTTCCCTCCCTCGCTCGCTCGCCCGGCACCACAGACCAAGTGCATCCACCCATCGAGCAACCCCC
AAGAAACACCGTCGTAATGAgcgactcgtcgtcgttgggcGGGGCGTTGATCGCCGCCGGAGTGTGCGTGCTGTTCCTGTTCTGTGTCATCGTCCTGTGC
GCCAGCTACTGCCACCgactggacgacgacgtggccatCGACTCGGTGGATCtgcgcagtctgcagctgcgcgaGGACCTGGTGGATACCGTTCTGGACG
CTGGACGCACCGAGTGGCAGTGTCTGGTCTGCGCGCACATGAATCACCCGAACCACGAGCTGTGTCTGCTATGTGGGACATCCGCCGAGTTCTCGACGAT
GcaggagacggtggaggaccCACATACACATACAAGAACATTGCGTGTGGCTAGAACCACAATCTTGGGCACAGACAGCAATGGAACGCTTTTAAGCTCG
ACGCTGTTGGAGAATTTAGGCGCGAATAACAGCAATAGCGCCGAGTCCAGTGCTGTAGTTTTGGAGGATAAAGAAGACTCGTTCAAGACTTCAGCAAATA
TGCTGCACAAGGCCAAGACGTTGCCAATGTTACGTAGTGAATCTTCTTTTGGAGATTCTCTGCACGAACTGGAGGCTACTACGAGTATGAGGCAGAGAGC
TCTGCGATACAGAAGATTGAACGAGATGCAGTTGAATCAGAAACAAAGAGgagcaagcagaaggagattGTGGCAGCGGGTGCCGCTGCCCAATGGAGGG
TTTGTGTGGGTTAGGACAATGGAACCGGCAGCTCCTGGGTCGGTATTTGCACGGGCAGATTCTTTTGTGCACAAGTTGAGGAATAATTCTTTTCTGACGA
AGAACCCACAAGCGAAACATTTGCATGGAGATTTGGCTGAACAATTGCATCGGAAAAATGCCGCGTCGATGGGATTTTTCACGGAACTTAATGCGTCGGG
CACTGCGGTGGCATGGAGGAAGACGGACTCGGTGGCGTTGGATGTGGATCCGaaaggaggagatggagaaccGTTTGTGGATTTTGAAGGCGTGTTGGCG
ATGACGTGGAGAGAAAAGAAACGCTGGTTCCTGAAGCAGATCACGAATCTGGCGGTGCCGTATACTGAGTCCATGTTTAAGATTGACGTACGTCGAAATG
CGATCTTGGACGATTCTTTGCCGCAACTGGCTGGGCCTGAAGTTGACCGATCAAGGATGCAGGAACATTTGAATATTGGCTTTATTGGTGAGCCGGCGCT
GGACGCTGGCGGTGTGCTGCGTGAGTGGTTCGGACTGGTGTGCAAGGAGCTTTTTAGCGCTGACCGAGGACTTTTCGTGACGACACATGCGGAGGACTCG
AGCTACTGGATTAATTCGGAGTCTGCAAAATGTGTCCTGGAAGGACAAGACCACCTTCAATATTTCACTTTTGCTGGCAGGCTTCTGGGCAAGTCCATTC
TTGACGGCCTAGTGCTGGAAGTTAGTATGTCGCTACCTTTGCTGAAACACCTTCTGGGTGTCCCTATTACGTTTTCCGACCTGGAATTTCTCGACGAGGA
ACTGTTTAGGCACTTAAGTTGGGTGCGGGACAATGACAATGTGGACGCTCTGTGTGTGACTTTCAGCATTCAGACGCCATCGGGTGAAACGGTGGAGCTC
AAACCGGGTGGAGAAAACATCGATGTGACCGATGAGAACAAGTTGGAGTATTTATCGCTTGTATTACGCTACCGCATGCTGGACAGTGTGAGCGACCAGC
TCACAGCGCTGCTGAAGGGGCTATACGAGGTTGTCCCGAAATCCCTGCTTACGATCTTTGACTACCAGGAGCTGGATTTCTACCTCAGCGGACTGCCAAC
AATAAATGTGACGGATTGGCAAAACAACTCGCGCGTTCGGCATGCAGCTCAGGATGACGACTCAGAAGGAATCGAGCAAGAACTTGAGGTGCTTCAATGG
TTCTGGGATGTCGTGGGCACCTTCACAGACGACCAACGCGCTCGGTTACTGCAGTTTGCAACAGGATGCTCGCGTGTTCCAGTAGAGGGTTTCAAGGCGC
TTACCAGTGCCAGTGGTATTGTGCACCCGTTCACGCTACAGATGGTGCCTACTGGCACGCCCCCGCTTGGAATGTGTCCACGTGCACACACATGCTTCAA
CCGCGTCGATTTGCCCGTGTACGAGACCAAGGAGGATCTCAAATCGTATCTATCTCTGGTAAGTCGCTGTGTGTTGGTTGGTCAAGTGGTGGAGCCTAAC
ACGCCATTGCGCTTTCGTGTATCTTGTATTTTTACAGGTGATTCAAATGGAGATTACTGGGTTTGGCTTCGAGTAATACTGCAACCTCAAATTGCTACAG
CTGCCAGGGGGAGAATTAGGTGATGAAGTATGTAAATGGTGATGAATTCTGGATAAAATATTGATATTACAGACAGATTGTAATGAGGTTTGGGACAAAA
CAGCTATTATTGTGATGAGTCGACGAGAGTTTGGTAGTTAGCCTGGATTGTGAAGGTCTCGTTGGAACGCTGTGACTCGTGTACGTAGAGATGACCAAGC
GGAGCAGGAAACGAAATGGAAAGAAGAGTAGCGAGTCCCAGAGCGAAGGTGGCGACAGTAACAACGTTCCCGAGACAGAGGATGAGAATCCGAGCCAGCT
ACCATCTGAGATGCTTCGTTCAAGCGGCCCAAATGTGGATTTGGCATTCTTGCGGACGAGCGGCCAACTCTATGGAGAGCTCCATCAACGTATAAGCAGG
GGAAGTCGAGAAGGTTACACAGAAGAAAACGTATTGCAGACTGGAAGGCAGCTCCTCCAAGCTCTGAGCGACTtggccgaagctgcagacccACGCTCCG
TTTCAAGAAACTCGTGTCCATTTGTGATGCTGCTATCCATACTGTTGCCAACGCTTCGGAAGTATCTCGCTTGGACAAAAGCGACACGAGCAGTGTGGGG
TAGTAACTTTGTtgctcttcgtcatcataGCACTACCCCAGAAGGAACTATTTACAAAGGCGAGGCTGACACCGTGCTGTGGGCAATGCTAGCGCAGCAC
AACATCCTTACACGATTCTCGCACCGGACTACGCACATTTTGCGACTTACTGAAAGCAGCGAAGACGTCAATCATGACAATGGGCATCCAAAACTAAGTA
TTCGTCAGACCAAGGCGGCCAAACCTACCTCACAAGCATCCTCAGAGTCGTCGGCGTGTTCTTCGATGGCGTCAACACCTCGAGATCCTATCACTGCACG
CACTCCTCGACTTACTCGGGACAAACCGATCTCAATCCCTCAAATTTACCACATTTCCATGGAGCTTGGAAATGTTGCCGCAGAGTGCAAAGTGCACCTT
GCAGATTTGACTGAGActcttgttgaagtcgtcgaaaTGGTACCGCGCCCAACTCGAACCTCCGTTGAGCTCCGTTTTTGCTGACAAttcgtgttggtg