Description :
From Genome Similarity Track
Location :
Scaffold_427:16985- 18067
Transcript NameFunction/comments
g2465.t1hypothetical protein

Sequence
1082 bases(100 bases per row)
ATTTTTAGATTTGAAGAGGATGAAATCGACCTCGACGGAGGAAGAAGCGAGTGGACCTGACTCCGCAGTATTCGCTGGTACTTCGCTAGAATGTCGGCCG
AATGAAAGCGATTCAGCGCTGCTCTCTCAGAGAAAGTCACGACCATGCCTGAAGCCCACGCACTCACTTGAGATTCCCGATGTGGCTGACGAGGGAGGAA
TTGACTCGATGGGCCTCACAATGCCCATGAATGACATTGTCTTCGACGCTGCTACCACCTCGGAACTGTTTGGAGACTGCAGCGACTTTGCTCTACATGA
AGAAAGTTGCTGGGAGCGGTTGCTAGAAGCCGAAAGTACTGAAACCAGCGAATTAGGTGAGATCGTCACGGTGTCACTGCGTCCAAGCCTCTCGGATTCG
CTTTCGAATTGCGAGGAAACCCCAAGCCGACCCGCGACTGTTTTACCACGTCCCCAAGGACGCAAGCGCCGCATTTCACGAAAAGAGCAGATGCACGACC
TCCGCAATACTGTGTCAGAGCTATCGACGAAGCTGGAAGGTCTGCGGACAGAGTCTCGGATGTGTTCGCCCATGACATCTCCTGTATCTTGCGCCGCAAG
TCAGCATGTGACCTCGATTCTTGAGCAGCCTCGATCACTGTGGGAACAAGTAGCTGCTCGCCAGCTCATACTGCGTTGTACAGCAGAAGAAGAGAACGCC
AAATTGCAGGAATTATTGGCATCGCAGAGACGCACGGCCCGCAACATCAGACGCTTGCTCCGACGGCGAGCCGATGACGAGGTAGACCCGTTGTTGCGCT
GGTTTTCTTAGTTTTGATGGCTAACAGATTCATTTGCTGAAACTCGTTATTTTGCGTCTGTAGCTGTTAGAAGTGATACACAACTCGAAGCGCTTGAAGT
GTGACAACAACGAGCAGGTTTTCCATGAGCTCCTACACGGAATTGATACGATTTACGTGGATTTTGGCAAGCTGTATGAAGCAAAAGGGATGCCAGCAGT
TCCTTGCCCTGGGCGGAAGCGCCGAACGGACCCCAATGCCGCCGACGGTGATGTCTTCGTTGAGTTTATCGACAAGAACCAA