Description :
From Genome Similarity Track
Location :
Scaffold_14:169827- 174725
Transcript NameFunction/comments
g1184.t1XP_009517844.1 hypothetical protein PHYSODRAFT_553558 [Phytophthora sojae
g1185.t1hypothetical protein
g1186.t1hypothetical protein
g1187.t1hypothetical protein

Sequence
4898 bases(100 bases per row)
CAGCATGAGCTACCGCGGCATGAACCCCAACGCCGAGATCGTGAGCAAGTCACAGGCGCTCATGGTCAACGTGAGCGCCGCCAAAGGCCTCCAGGGTGTG
CTCAAGTCCAACCTCGGTGCGTCCTCCCTCTCTTAACAGTCCCCCCAAGGCTAAAGATCCCCATCTAACCACAATAACAGGCCCGCGCGGCACGCTCAAG
ATGCTGGTGGGCGGTGCCGGCCAGATCAAACTCACCAAAGATGGCAACGTGCTGCTGCACGAGATGCAGATCCAGCACCCGACGGCTGCGCTGATCGCGC
GCGCGGCTACTGCCCAAGACGACGTGACGGGTGACGGCACCACGTCCACCGTCCTATTCATCGGCGAGCTGCTGAAGCAGGCGGAGCGCTTCCTGGCCGA
CGGTCTGCACCCGCGCATCCTGTCTGAGGGCTTCGAGCTCGCCAAGGACGAAGCGCTGCGCGTCCTGGACAGCATGAAGACCACGCCCGAGGATATTCTC
AAGGATCGCGAGCTGCTCTGCAGCGTGGCGCGCACCTCGCTGCGTACCAAGCTGGACCAGAAGCTGGCGGACCAGCTTACGGAGATCATCACAGACGCCG
TGCTGACCATTGCCGCGCCCGAACGCCCCATCGACCTGCACATGATCGAGATCATGCACGTACGTGTCGTGTGGTGAGTGTGATTATTTTTTAGTGATGC
TGACGACTGTATTGTGTTGTGTTTGTTTGAATTTGTGCAGATGATGCACCAGAGCAGCAGCGACACTCGTCTTGTGAAGGGCCTGGTGCTGGACCACGGC
TCGCGCCACCCGGAAATGCCCACGTCGCTGGAAAACTGCTACATCATGACGTGCAACGTGTCGCTGGAGTACGAGAAGAGCGAGGTGAACTCGGGCTTCT
TCTACAACAGCGCTGACCAGCGTGAGAAGATGGTGGAGGCTGAGCGCAAGTTCACTGACGACAAGGTCCGCCAGATTATTGAGCTGAAGCGCGAGGTGTG
CACGGAGGAGAACAAGAAGAGCTTCGTGATCATCAACCAGAAGGGCATTGACCCTCTGTCGCTGGACATGCTCGCTAAGGAGGGCATTCTGGCTCTTCGT
CGTGCCAAGCGTCGCAACATGGAGCGGATAACGCTTGCTTGCGGGGGCATGCCCATCAACTCGACGGATGACATGGACGAGTCCATGCTCGGTTACGCCG
GCAAGGTCTACGAGCAGACCCTGGGCGAGGAGCGCTACACGTTCGTGGAGGACGTGCAGCACCCGAAGTCGTGCACGATTCTGATTAAGGGCCCCAACGA
GCACACGATCGCGCAGATTAAGGACGCCATTCGCGATGGCGTCCGCGCTGTGAACAACGCCGTTGAGGACAAGGGTGTTGTACCCGGTGCTGCTGCCTTC
GAGCTGACTGCCCACGAGGCGCTGAACAAGTTCAAGGGCACCGTGAAGGGCCGCGCTAAGCTCGGCGTGCAGGCTTTCTCGGACGCTCTGCTGGTGATCC
CGAAGGTGCTGGCGGAGAACTCTGGTCTAGACGTTCAGGACACTTTGATTGCCGTCCAGGAGGAGCACCAGAACTCGGGCATGTTTGTGGGCATCGACCT
GTTCTCGGGCGAGCCCATGCTGCCGGAGCAGGAGGGTATCTGGGACAACTACCGGGTGAAGCGTCAGTTCATCCACCTTGCCACGACGCTGGCTTCGCAG
CTGCTGCTTGTCGATGAGGTTATGCGTGCTGGCAAGCAGATGGGTGGCGGCGGCGGCATGCAGCCCGAGCAGTAAGTAGGGAGCGGAGGCGTAAGTAGTT
TATTTCCCACACCCATCCATCTACTCACCACTCATCTGAGTCATAATAAACAGAGAAACCCCACACAGAAGAGCTTCAAGACGTCGGCACACAGGCTGAA
AGCACCGTCCTTTTAACACTAGTTAGCGCACAAACAATAGATAGAATACCAGGACGTCCGTGATCGACAGCGCCACGACGACGAACCAGAGACACACTTT
CTTCCGGTACGAGCGGTCGGCGATGATCTGCAGCAGGTGGCGCACTTGGCCCGTCATGCTCGAGGTCTCGGACACCATCCCCTTCATGTCGTGGAGCTGC
GAGCGCTGCAGCTCCAGGTCCACGAGCACATTCTTGGCCACCTCCTCCGACTCTGCCACTGTGCGGCGCGTGCGCTCAATGTTGTCGGACGTACGCATGA
GCGATCGCACGCTCTGTACACAGGGAAGCATCGAGTTAGCTGCTACAAATCGGCACAGACGCCGCGTCGATTGACACGCACCGGGTCCGCCGCGAAGAAC
GTGCTGTAGTTATTAAGGCCGGTGGCATCGGGGCCTCCACCGGTGACGCCGCTGCCGCTGTTGCCTCCAGCGAAGATACCGCCGCCGTTGGACGCATTGT
AGCTGCCGGACATGGCGCCTGCCGTCACTTCCTGAGCTCTTGGCCGCTGAGACTTCTGTGGAAGAGGTGTTCGAAAGATACCGCAGCTAGAGGCCCACTA
CAGAGTTTTGTCTGTCGGCCCAGTACCTATTTTGGTGTGCTGTACACAATCCACATTTTGGCGTGCTATGAGTTTCGGCAAGACCAACTATCGCGTGGGC
GGCACTCGCGGTGGCGCCGATCGTACGTGGATGTAGAGCTTCCTGCTGTGGTGTCGCGGTTCTCCGTGTGTATTTATCTAATAGTATGGCGATTTTCTCG
TGTGTCTGCGCTCCAGAGTTCAAGTGGGAGGACGTCAAAAACGACAAGTACCGGGAGAACTACCTGGGCCACTCCGTGCAGGCGCCTGTGGGTCGCTGGC
AGAAAGGTGCGGTGTAATATCCGACATAATTGATATAGTAAACTGTGCGTCTTATTGGTATTGTGCCGGTTTGATCGCAGGCAAGGACTTGACGTGGTAT
GCCAAAGCGAGCAAGTCAGAGCGAGCCGAGGCGCTGCAGGCAGAGCTAACGCTGGCCAAGCAGCGAGATGAAGACCTGATGAACGAGGCTCTGTACGTCG
CTGAGAAGATTCATTATTGGCTGGAGTTGCTGACGAGGGGTTGATTGACTTTTGTGAGCAGGGGTATCGCTCCGAAGAAGCGCCGCGAGCATGGTGAAGG
TTTGAGTGCGTCGGAGATGAAGGAACTACTAAAGCGGGGAGAGGCGGGGCGTGATGGGATGGATGTGGAGCGTGTTGAGGGCTTGGGTGTGGCGCCGGTG
GATGCTGATGGTTTTGAGACTGGACCGAAGCGCACACTGGCGGAAAGATACAAGGACCAACTCGCCAGCGGCAAAGCAGATATTACGTATGCGCTGCCAG
GGACTGTGAATGAGAACATGACGGAGGGTGAGATGAAGGCTGCGAGAAAGGAGGCGCGCAAGGCTGAGAAGGCTGGTAAAAAACTCAAGAAGAAGGAAAA
GAAGGAGCGCAAGAAGGAGAAGAAGGCAAAGCGTCATGACTCGGACGATGCAGGCGATGAAAAACCTCGTCACCATTACCACCATCGCCACAATAGGGAA
GAGAACCCCGGGCACCGCTCACGTTCTCTTTCTCGTTCACCGCCAAGGCGTTCCGATAGGAGCGGAAATTCTGCTCGGCGATCGCGATCCGCCAGTCGTC
AGCACCGATCCCGATCCTATTCACGATCTCCAGCCGATCGTCGTAGGCATGACACTTCAAACAGAAGATATCTGCTGCAGGACGACTCGCGTGGACATTC
GCGATCTCCCGGGAGCCCTTTCAACCGGCGTCGTCATCGCTACCGATCGTCATCGCGATCCCCTGCCCCGAGGAGACGAACGCGCTCTCGCTCTCGCTCG
CGATCGTGTCGCCGCTATTGATTCATCCAGTAATTGAACGGCATGGAGCAGTGCATGTTGCGGTAATTTCTGCTTGGGCTATAGTAGTACATACGAGCGC
CATTACAACTCTTCGTCTCGCTCTTTATCTTTTATCCATGCAAGACGATGCTGCTATTACCCACTTGCGATATCCATAGGAGTTTGCAACATATACAGCC
TTAAACATGTTTCGCAACTATCTATTCAGACTTGGATGTTGTGTGGGCCTTCTTCTGACGCCCGCAGCGCTCAGAGCTGCCGTCCTTGAGGTCATACGCG
GGCAAGTAGTAGCCCTCTTTGCTGTCTTCGCCCTTTCGCCAGAGTTCTGGGTTCTGCACGGTATCGAAAATGTTTCCTAGCGATGTGTAGCCGTGGTCGT
ACAGTGAGCAGTACTCCAGTTGGCAGTCGCGCAGGAAGCTCCACACATCCGCGTATGTCCAGCACAAAATCGGGTTCACGCGCAGGAAGGGCGGCCACCC
AGGGCTACTCGGCGAGAAGTGCTCCATGTCCTCCGTGTACGGGTCACCTCCACGAACACCCATGTACACGCCCTTGATCTTGAGCTTCTCCAAGATGTCC
TTCACGCCTTCAACGAACGAGCACTTGTACACGTGACAACTGAGCGCATACTTCTCGGTGCACTGCTCGGTGAACTCCCGCACCTCCGGGAACTGGTCGT
ACGAGTCGAAATACATGACTGGCACGCGCTGCAATTGCGCATTCACTCGGGTTTCGAGCTCGTCTTCGTGCAGCAAGTCAGCCGAGACGAAACTGTTTCG
CGGCGATGTAACAGTCGTCTTGGGGCCGCCCACAGCTTCCTGCTGGATCTTGTCGTGTGCCTGCTGCGCCTCCTCCAGTACGCGCTTGCCCACCACAATA
CGCAGCAGGTGGAGCACCACTGTCGAGTCTTTCCCCCCGTTGAAGCTGAAGCAGACGCCCTCCAGGCCGAAGATGTCGATGGCGCTGCGAACCACGTCCA
ACGCCTTCTGCAGTCGCGCTTGCATGGCCGGATCGGCGGCGGCGAAGAAGAGGTCGAAGCGCAGCAATATAGACCTCATACTAGAGTTGATGGTCATG