Description :
From Genome Similarity Track
Location :
Scaffold_437:16982- 21317
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_437-snap-gene-0.15Small mechanosensitive channel family protein
Pytul_var.sporangiiferumsnap_masked-pug3_contig_437-abinit-gene-0.25Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_437-snap-gene-0.16Gene of unknown function

Sequence
4335 bases(100 bases per row)
TCTTGTGCATGCGCAGATGGATCGCGGACGTGCAGCGGTACATGCTGCTGTACCTGTCATGGATCTGCTTCGCACTGCTGCTGATCTTGATCGCGGTCAA
CGTGCTGCAGCTGGGCGACGCGGCCGACAACGCCGTCTCCAAGGCGCTCTACTACTTCCTCGCCGCGCCCGTCGTGCTCGGCACCTTTGCGCTGCGCAAA
GTCGTCGCCAACGTGCGTATAGGCTATCTACTGCCATGGGTGGCAATCGTTCTGTGGGTGTGGGTGTATAACGTGTTGTATGGCTCGGTGTGGCAATATA
TGCAGCTTATCATCCGCTATCTGAAATGGGACCGCGGCTCGACCGACTACGACGCCAAGATCTTTGTCGTGACTGAGGGCGTGACGGTGCGTATATCATA
TCACAATGGTGCTATTGCATGCTGCTCTCTTGGTTCGCACGCTTGCCGACACGACTCGTTTTGGTTTCATGACTTGCCATGCAGTTTCTATGCTTTGTGC
TCATCGTGGTCGAGATCTTTTACATTTTCTTCGTGTCGAACGAAATGGCGAGTTTCCTGCTAGTCGAAGTGCTCGTATGTCTCGAAGTCCTTGCGTTATG
CGCAGGCTTCACCACGGTGCGTTTGCTCTGCTGTGTATGATTTTATCCATGGTGTATCCTTCCAACCTCCTCCTCTCAACATTGTGCATTTTTGTTCCTA
CTTGCAGCTCAAAAATGTCGCGACGGGGCTCTTCCTCATCTTTGTCGAACCCTTCCGCACGGGCAGTTGGTGCCGCCTGCAGCAACTGTGTGGCTTCATC
GAAAAGGTGTCGCTCGCGCGCACGATCCTGCGGCGGTATGACGGTGCGCTTGTGTTCATCCCCAACGGTATCTTCGCCGACATCCACCAGACGAATGGGA
ACGCCCAGGACGCACAGCTGCATGAACTCGTGCTCCAGGTGCATCCGGCGACGTCGATCGACAAGATCCACCAGCTTGTGGACGAACTCACGACCATCGT
GCCGCAGTACGCCATGCCCGAGGACTACTCAATGAGCACTCAGAGCCACACGACGTTCACGCGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTACATGCATCGCCACAACACGCTCAGTGGAGCAGA
GAGTAACACAACGTACCGCGTCGTGCTCCAGGCCATGTACCGCGTCAAAGTCATGGTTCTCGTCGATCGCGCGCGGTTCTCGTCCCTCGAGGCTGCCAAG
ACCGAGGTACGAAGCTTTTATTTCTGTAACAAGCTGCTGCTGCTGTTATCCTCACAGCAAGATGATCATGATTGTGTATATTTGCAGATAAATATGTCGA
TTATTGAGAGTCTTCAACGCATTGGCGTTGTCGCGCGGCAAACCGTGCACTGAAGCCATTTTCGTCCAACTTCGGCTACTTACTCAGCCGAAATCCATGC
CTTCATAGGATTACAACATGGACGATTGCTGCCGCCGTTGACGCATGCCGTTGGTGGCGCTCTCGCTCACATTCCGTCGGAAGCGGTCAAAATTGGGAGG
CAGACTCGATGGCGCACGCAAGGTTGCTCCTGTCGTAGGACTCAACAGGTCGCCGTTCGCGTTGCTGCTCTCAAGCACTGCTATCTTGTGCTTCGGCGGC
AGCGTCCGCGCACTAGCTGCAGAAGCATTCTCGCCATGCAACTTGAGCTTGAGCTTTGTCAGTAGATCGGTAACCTGCAAAACAACCTAAATATGCAAAA
TAGGAGCAACAAGAACACGTAAGCTCCCGTCATTGCGAGGGGGTGATACATACTGAGCGGCATACCTCGGTTTTCTCAGCCATGATGGCTTTGATGTGGC
GCTCTTGCGTGTAGTACACGATGTGGACCTTGTATGGCGCTTCGACGCTGATCCAGAAGCGCCCTCGTGTCGAGTCTTCATCATCGTCGTCTTGCGGTGT
TTTCGCGAGCAGCTTGGACGTCGTTTCATAGATTTGTTTCAACTCCCAGCTGCCTCGGGGCTGATTGACTTTCTTCTCGAGCCCCATCACGACTTTGGCT
TTCCGTCGGCGATGCTTTTCCGCTTGCAGGTGCAGCAAAAAGCTGTCGAGCTCTTGGATCAGCACGCGCATCGCAACAGCTTTCGTGCGGTGACTGAGAT
GCACTGCGATCTCGCAGCGGCGATCCAGGCTCTTGCTTTGGATCTCGACCGTGTTCTCCAGAAGGATGCCATTGGGGATGTANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTCGTGGCCCTGGAAGCGGATATGTGACCCGCCTTTGAT
CTGCTCATCCAGCAGCGCCATCAAGCCGCCCATAATGTTCTTCAGCTACGTGTCAAGAACGAAAACAGCAGGGTGAGCTTTCCTCCTTTCTTACGTACAC
ATATAGGATACTGAAATGGCACAAGGTACCCAGGTGTGGGCTCCAAAGACAAAGATGAGCTCGACCATGAGCACAGCGACCGTCGAGATCTGCGACGAGT
CAAAGTCCGTGATGTTGCCGATGCCGTCCATCATGAACGACGACACGACGGCCGTGACCAGCAGGATTTTGATCANNNNNNNNNNNNNNNNNNNNNNNNN
NNNGCCATACACAAAGCAATAGACACGACATAAAGCTTTGTTAGGAGAGAAGAAGCACCGCAACTACAGTGCAGTATAATAAAACGTTCAAGCAGCGTAC
CCCAATGCCTTCGGTGATGATCATGACGCGACTGTAGTCGTCATCATCCTTGGACGCCGCGCGGTTCCAGCCTTTCACGCGAATGATGCCCTGTTTTTTA
TAAGCATCCATGTACATATATACACACATGCACAGCGTTGGCGTAATGACACATGCGCCCCAGAACAGCCAAATACGACGTACCCATGTGACGTAGTTGC
AGAAGTTGATGACGACCCAGATGAGCGGGAAGCCAAGGATAAGCGTGACGATGCTCGTGAGCGTGTCGGACTCCAAGCCGAGCACGGTGCTCAGGTCCAT
GACGTACATGGAGAGCCAGATGAGCAGAATGAGCACAACCCAAGAGAGTGGCATGAGCAGGTTCTTCTCAAACTCCTTAATCCAGACGAACATGCCCGGC
ACGGCGCGCCGCACGAGCCGCAGCGAGAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGCCCTTGCTCGTGCTGTTGCCGCCGTCGTCATTCAGCGCGGACACGCTGTCGTCCGCTACC
ATGATCGCCATTTTCCTAATACCGGTAATTGCTTTCTTTGTGTTTGTATGTGAGAGAAAGCTTAGGTTCGCTCTTTAGGCTTAAGTTCGAATGCTGTGTC
ATTTTTCACCTTGTTTTGAAGTTGGACTGGTTGTATACTACCCTGTACTAGTACAATAACAAACCTTGTTTTGCTGAGCATTGGCNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACGCCATCGCGGCGGACCAAGAGCTCGTCACGCTGCAAG
GCGATGTGTGCTTGAACGGCTCGGCATGGCTCCATCACCTGACCAGCAGCAGCAGCACCACAACTGGCATCCCAGAGGACCAGGTCACGGCGCTGCAGAA
GGAGATACAGAAGATGCAGCTGAGCCCGACTGTGCTGCTCGTGATGGCGCTGCTCTATGAGCACGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAAGCAGATCCCGCTGCCGATGACTTGGGACACCAAGGCACGACGCGCGCTCAAGCACACNNNNNN
NNNNCGTGCTGCTCTGTAATGCGCATTGTGTCACTAAGCCCTCGTTGCTTTTGTTTGTGCAGTGCGCCGTCGGTCGATCAGGAGCTGGTCGCCAACATGT
TTGCAAGCTTTGCGGCGCCCCTCGCAACAAAGTTTCCGTCCATCTGGCCTGAGAACGTGGCGAAAGATCCTGCGCATTTTCAGTGGGCGTACACAGTGGT
CTCGTCGCGCGCGTTCACGATNNNNNNNNNNNNNN