Description :
From Genome Similarity Track
Location :
Scaffold_53:16982- 18533
Sequence
1551 bases(100 bases per row)
TTAAGCTCGACGATAGGGCAAGAAGCCGTAGGGGCAATGCTGTCCGCTCTGGGTCCAGACGGGCAACTCGCCACCATCGCCAAATTCATTCAGAATGAAC
TTGATGCTAAACGGGGAAAGTAACCTTGCTTCACCAACAAGGGTCTCAATAGACAGAGCTGCTGAGAGAACAGCGTGATCAACAGTTCGAGTTGTTGAGA
CAGCAGCAGGCTGCTGCCACCGGGTCGACACACTCACGCCGACCCGAATCACTGATGATTGACAGCTCCAAATACAAAGCAGCTGAAGAAGATTCTCTGC
TGAGATGGTTTGTTGAGCTAGATGACGCCATAAGGGCTCGTTACATCGTCGACGAGCAAATGCATGTCGCATTTGCTCAGTTGCACTTGGCAGGGCGTGC
GTAGACTTGAGCCTTGGGCCTCAAGCTACACGACTTATTTGGATCGGGTCGTTATAAGTGTTCAAGTCCCTGCTTAGGCAAACATTCAAAACACTGAGTT
CAGGGCTCTCTATGAACTCCTGAAACTCAAACAAGGCAAACGTGATGTACACTCGTACATTCAGTACATACGACATCTTACGAGTTACATCACAGCAAAT
CCGCTGAATGAACAAACGTTGATCACGTTGTTCATGTAAGGCCTCACGGACGGTCCAGTCAGGACCTATCTCTTTCGGTTGAAATTTGATACCCTGAAGG
AGGCAATCCGGGTTGAGGAACAAGAAGATTTCAGCGTGACACAAGCTCACGTGGGTTCAAACTCCTATCGTCACCTCGAGGCGACAGGAAAACGGAGGCT
CATAACCGACGGACCTCTGTTACGCTGAGCACTCAAGTCCTCCCAGTATTAATTATAAGAAATTGCAGACATGCAATAGGTGTCAAAAACAGGGCATTAT
GCATACGAATGCAGTGCCTCGAACGCGGTGCCACATACTGCAGGAAACATTCACCGTCAAGCGACCAAGAAGGGTTCAACGCGTGGGTCCGAAGCTGTTG
TGAAAATGCAACACCGGAACAGACAGTCGAAAACGTTCGGGTTTAGTAGGTGCAGAGTACCCTACTGATCCAGAAACGTCAAGTGAATTTGCAGGCCTCT
CAACGAGATTTTCTCCCAACACGCAATCATTGTGTGTTACTGCATCTGGTAATGAGGTTTCCCTCACTACCTTGAAGCTCGAAGTGGCAAAGGACATGTC
ACTATGAGCCCTAGTCGATTGTGGAGCGTCGAACAACTTTGTACGACGCCAGTCGCTTGATGAAAGCAAGCTCAATTTAATTAAGCGCTAGATCCCTCCA
ACGGGAATGACTGTAGGCCTCACTACACGCGCATCCGTAATAGCGCAGAACCGTGTAATGGGAATTTCCTATACACTAAAGAAGTCCAATACGATGAAGA
ATTTATATCATTGGACTTGGACGACAAGTTTGATGTCATCCTCGTTCTACCGTGGATCAGAAGGTACGAGCCACAAGTCAGCTGGCATCGACGAAGTGTC
GATATGCCCGCCGCTTTATCACCAGACGCCCATCTGATGAACGTCTTGGAG