Description :
From Genome Similarity Track
Location :
scaffold_508:16979- 18237
Transcript NameFunction/comments
g8865.t1hypothetical protein
g8866.t1 serine protease family S10, putative

Sequence
1258 bases(100 bases per row)
ATTGTAGTCGTGGTCATCACCAGAACTGTACGAGAACCCCACGCTGGTCGGTTGGTCCAGCCAAATCATGTTCGCCTCGTACGTCCACGAGTACGGATGC
ACCTTCGTCGTGAGGTCTGGCTGAATCCGACACGGGCCGTTCTCGTTGAATAACGCTAGTAAACTCGACCCACCAGGCCCACCAGTCAGCCAAATCACCA
ACGGAGCTGTACTCGCATTGTATTTTGCCTCAAAGAACCAGTAGAAGTAGTGGTCGTCGTTCTTGTTAGGCAGTTTGATATACCCAGCCTCATTCTTGGT
GTCACCGCAGATAAACTCGTCCACAGCCACTGCAGACTTGTAGTTGTCGAAGAACAGCCACCACACACTCCATCCAGCCACAACCACCGCCGTCGCAATG
CCCAATATAATCAGACAACGCCTGATCTTGAGTTTGTTGCTGGTGGAGCCGTAGATGGCTTGTACGGCAGGAAGCAGCCGGGTTTTCTCGTTCACGCGCG
CCATAGGGGGAACGTCCTCCTGATTGCAAACTGGATTCGCAGACTCATCACAATCATTCCTATCGAGTCAGCGTTAAGTACGCAAAGAATGTATGCTAAA
CTTCAATGTGCGCTCGTCAAGATAGCATTTGTGCTAAGCTGTAGCTGTTACAGCAAAAAGCCATGGACAGAATCATATCACTTTGCATAATGTAGCCCCA
CGCTCGATTTCCAGACATGAGAACTGGCGTCTCACACGAGTCGTGACACGACGGTACACTGCGCAGTAAACAAGTAAAGTTAATTCCTGAGCTTCATTAT
TCTGTCTGATCAGTTGATATCACATCATGTTACTATCCATCGCACTCATACTGCCTGCGCATTTGCGGAATCTGGTCTGTTGGTCATACAGTCCTTTGTC
CTCAAAGGTCTTGATTCTGGTAGAAGCGGTTAATCATTTCCAGCGCAACGGCCGGTTGGTCTTGCGGTACCATGTGCCCCGCGTTGAAGACACGGACAAA
AGCGAGGGCCTCGGATGAAATGACTGAGCCAGCAGTGTCGTCATCAACAATCAACTCACGTGTTTCGGCCGCAACAAAATCTGGCGAGCCCTTCCATTCG
AGATCTCGCAGCCACGCCAGGTTTCCTGACCAATTGCACTCGAGATCTGCATCACCAGCATAGATCAGCACACGCACGCCGTTGTCGAGAAGATCACCGA
CAAAGCCACTGGTCGATAACATCACGTCGAACGACAGCGCGAACGCAGAATTCACAGC