Description :
From Genome Similarity Track
Location :
Scaffold_101:169786- 172862
Transcript NameFunction/comments
Physo_141640hypothetical protein
Physo_109410intracellular transporter
Physo_109411ribosomal protein S19
Physo_109412predicted protein

Sequence
3076 bases(100 bases per row)
TTCCTGGCTACGGAATCTGCCAAGTTGAACTGGAGGAAGGAACGATCGAGTTCGTGAGCGATGAAGCCTCGACTGACATCACGATGCAGGAGGCAACGGG
CTCGGGCGGTGTGCGCTCACTGATCGTGGACTTTTGGCGCCTGGAGGACGACGCCTTGGTGACGCGCCTGCTACGACTAATCGGCAGGAACCTCAAGTCT
CTCGCGCTTGACTTTAGTGAGACCAGCGACGACGTTGAAGTCGATTTGAGCGAGGTTGCGGTGGCTTGTCCTATGCTGAAAGAACTTCGGCTTGAAGGCT
GCAATGCGTCGATCTCAACACACAACGAGGCCCTGCGTAACTGGGGGATCAAGAAGCTGGAAATCTACGAGAGCAGAGCGGTGGATGGCCTCGAGACGTT
GCTGAGCGACCAGTCCTACCGAACGGCGCGGGGGCTGGTGGAGCTGGCGTTCTCTGCTCCGCCCGACAGCATGAACGAACACTTCTTTGGGTTTTCGTAT
CACGGGATGCCGGCCGAGGATAATAGATTGCCGCGGGAGTATGTGAGCGCGCTGATGGCCCACCGCGGGGAGCTGGTGATCAAGGAAAAGTTTCCTGTGC
GGCCGAAACTGGCGATGCTGAGCCCCCCGATTCCTCTCTGAGATCGATGCAATACATGGACTCGAGCATCCTGAGCCGGATCTTTGCCTTCGCAGCGGTT
CCAGCGCAGCGCTCGGTCGACAAGTATGATGCAAGGGTGCGGTGAATGACGGCCGCAACAACTGAAGTAGCGAGCTACTTACTGTTAGGTAGCATTGTAT
ATATTTGAAGCCGTCTTACCGTACTTCACAAAGTAAGCAATTGCCAAAATTGCAAAAATGCTCTCGCTGAAAAGGTGGCCGCGAACTCAAAAAAGTGTGC
GGAAAAGATCGCGCCCTTTCAGACGTTTTGCGCCGCAGAAACGAGCGGCCTTTCCGATACGTTCTCGTACTCGGCAAGTTGCTACCAGCGGCCCCCGGCA
GCAGGAACAGCGATGTCCATGTTCGTGGTGGTGGGCTCCAAGGAGCCGCTGTACAAGATGGAGATGCGCGCGCGGCGGGAGGAGAGCGCGCACGTGGACG
AGTTCGTGCTGCACGCGGCGCTGGACCTGGTGGACGAGCTCATGTGGACGACGCCCGCCATGGCGCTCAAGGTCGTGGACCGGTTCAACGACCAGCTCGT
GTCGGCCTTCGTCACGGCCTCGGGCGTCAAGTTCCTGCTGCTGCACGAGACCCGCAACGACGACACCGTCAAGGCCTTCTTCCACGAAGTGCACGAGCTC
TACGTCAAGGTGAGGGGCGCGCGCGACGGAGAAGATCCGGGGTTCGTCTGTCAAGATGCCAACTACTGCTTCTTGTTCTTCTTGTTGTCCCTACTTGTAG
CTGCTGATGAACCCCTTCTACGAGCACGACACACCGATCTCCTCCGAGGTGTTCGACGCTCGAGTGAAGACACTGGCGCGAAGATACCTGTAACGCGCGA
AAACCAACTCATTGACACGATGCAAACTCTTCCACGACGTGCAACAATTCAACATGAACACAATGAACACCACAGTTGGGAGTAAAGCCGACGCAGCGTG
CGAGCGCGCGTCTGAAGTAGCTTCGATTATTGCAAAATAGCTCTCTGGTTCATTCCGGTTAAGTGGCGGCTGCGCGTAGCGACCGAACTTAAGCGCGCAC
AACCTGGCCGGCAATGCGGTCCAAGTCCTGCTGGCCGTGGCTGCTGATCTTGCGGCCACCCTTGTTCACGCCCTCAGGGCACTTCTCCACGACCTTCATC
TCCTCCAGCTGGTGCAGGATGTGGCGGATGAGACCGCCCGAGGCCTTCTGGAAGTGCTGGCGGTGCACGCCCTTGCGGGCGGCGCCACCGTACACCTTCT
TGAGCGAGCCCACACCAGTGTACTGGCGCAGGTACACCTTGCGCGCGATCGAGGCGGCACGGATGTAGTACCAGTCCGGGTCGGCGGGCGAGTACTCCTT
GAACGAGGCCGTCTTGACCACGTCCCACCAGGCGGGCAGCTCGATCTTGCCCGAGCGCTTGAGGTGCTCGGCGTAGGCCTTGATGAAGTCAGCGGGCTTC
ACGTCGCGCACCGTCACACCGCGCGTCACTTCTTCCTCGTCGTAGTCAGCCATGTTGGAGTCTGTAGCGTAAAAGGGAGGGGGGGGGAATCGGGAGGAAA
CACGGAAGTTAAGAACACGTCTGTACCACCGCACTTCCAGGCGGGACTCAAGCCATGATAGCCGAGTCCACGTCAGTCGCGCAGGACAGTCTCGGTCTTA
AGACACATCGTTATTATAAATAACGACACATTCCAAAGCTCTACGACGACTAATCCCGCGCTCTAGCACAGCAGAGGGCATGGGGGCACGTACTTGTTAG
GAGAGGAACTTTGCAACAAATGCCGAGCTGTTGGCGCCGCCGTCCGGGCAGCCCCAGAAGCCCTCCGCCAGTGAAAGCTGCGCGCGGACTTTCGGCCAAT
AAGAACGGTTAGAGCGGCCTATTGGCGGGCCGCCAGTCGATGCGATCGGATTTGGGAGGGCACATGCCGGATCGCAGGTCGGCATGCCAGATCGTAGGTC
TGGCGGTGTCCATTGGCTGGCCTGCACCGAGCGCCCTTGAACGCAGGATCAGTCGCGAATCGGAGTCCTCCGCTAAGACAGTTACGCTACTAGCTACCTA
CGATGTTGGTTCTGTTCGAGACGGCCGCGGGCCACGCGCTGTTCAAGGTGCAGGATGAGGCCAAGCTGGCCAACGCCGACGACGTGTTCAAGCACTTCGC
CACGCCCGAGAAGGCGGCCAAGGTGCTGAAGCTCAAGGGCTTCAATGCCTTCAAGGACACGACCGAGGCCGTGGCCGCCGCCACCGACATGGTGGACGGC
AAGATGGGCAAGACGCTCAAGAAGTTCCTCAAGAAGAACGTGGTGGACGCCGGCCTCAAGGACAAGCTGGCCGTGTCGGACAAGGCGCTCGGCTCGCTCA
TCAAGGACAAGCTCAGCATCTCGTGCGTCAACGACAGCGCCGTGAACGAGGTCATGCGCGGCATCCGCGCCAACAT